ID: 909149787

View in Genome Browser
Species Human (GRCh38)
Location 1:71987417-71987439
Sequence CTGTGGAAGGGGTAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 550}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909149778_909149787 13 Left 909149778 1:71987381-71987403 CCAGGGAGAAATACAAACCACTC 0: 1
1: 0
2: 2
3: 59
4: 217
Right 909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG 0: 1
1: 0
2: 5
3: 46
4: 550
909149780_909149787 -4 Left 909149780 1:71987398-71987420 CCACTCACGTGGTACTGATCTGT No data
Right 909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG 0: 1
1: 0
2: 5
3: 46
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909149787 Original CRISPR CTGTGGAAGGGGTAGGTGAA GGG Intronic
900629038 1:3624239-3624261 GTGTGGAGGGGGGCGGTGAACGG - Intergenic
900808990 1:4786941-4786963 TTGTGGAAGGGGCAGGGGTAGGG - Exonic
901588618 1:10319751-10319773 CTGGGGTAGTGGTAGGAGAAAGG - Intronic
902361315 1:15943948-15943970 TTGTGGGAGGGGCAGGTGAGGGG - Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902413483 1:16225741-16225763 CTGTGGAAGGGTTGGGGGATGGG - Intergenic
902872810 1:19324610-19324632 CTGTGGAAGAGGAAGAGGAAGGG - Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904620252 1:31770856-31770878 CTGTGGATGGGGTGGGGGTAGGG + Intergenic
904660593 1:32081502-32081524 CTTTGGAAGGCCAAGGTGAATGG + Intronic
904698106 1:32341846-32341868 CAGGGGAAGGGGGAGGGGAAGGG - Intergenic
904719729 1:32499086-32499108 CTGAGGAATGGGCAGGAGAAAGG - Intronic
905274107 1:36806065-36806087 CTGTGGGAGGGGTGGGTGTGTGG - Intronic
905298873 1:36972467-36972489 GAGTGGAAGGGGTAGGAGCAGGG + Intronic
906306475 1:44723220-44723242 CTGTGGAAGGAGTCAGTGATTGG - Intronic
906642230 1:47448355-47448377 GAGAGGAAGGGGTAGGGGAATGG + Intergenic
907102493 1:51849571-51849593 CTTTGGAAGGTGGAGGTGGATGG + Intronic
907760475 1:57353746-57353768 GTGTGGAAGGGGGAGGAGCAGGG - Intronic
908486572 1:64600089-64600111 CTGTGAAATGGGTAGGAGAAAGG + Intronic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909506095 1:76391582-76391604 AAGGGGAAGGGGAAGGTGAAAGG - Intronic
909899020 1:81109589-81109611 CTGGGGAAGGGGTGAATGAAGGG - Intergenic
910561984 1:88600626-88600648 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
910633323 1:89379892-89379914 CTTTGGAAGGAAGAGGTGAAAGG + Intronic
911513452 1:98837386-98837408 TTGTGGAAGGGGCAGTGGAAAGG + Intergenic
911748563 1:101468612-101468634 CTGAGGAATGGGAAGGGGAAGGG + Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912687795 1:111780521-111780543 CTATGGAAGTGGTGTGTGAATGG + Intronic
912755462 1:112321389-112321411 CTGTGGAAGTGGCCTGTGAAGGG - Intergenic
912879332 1:113392041-113392063 TTGTTGAAGTGGTAGGTTAAAGG + Intronic
913485926 1:119332837-119332859 ATGTGGAGGGGGAAGGAGAAAGG - Intergenic
913668031 1:121068428-121068450 CTTTGGAAGGCCCAGGTGAATGG + Intergenic
914019721 1:143855558-143855580 CTTTGGAAGGCCCAGGTGAATGG + Intergenic
914167636 1:145189071-145189093 GTGGGGAAGGGGTAGATGAGGGG - Intergenic
914253861 1:145944782-145944804 CTTTGGAAGGCTGAGGTGAAAGG + Intronic
914519152 1:148400081-148400103 GTGGGGAAGGGGTAGATGAGGGG + Intergenic
914643645 1:149634116-149634138 GTGGGGAAGGGGTAGATGAGGGG + Intergenic
914658273 1:149763774-149763796 CTTTGGAAGGCCCAGGTGAATGG + Intergenic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915720676 1:157983114-157983136 AGGTGGATGGGGTAGGTGTAGGG - Intergenic
917097884 1:171417796-171417818 CTGTGGGAGGACAAGGTGAAAGG - Intergenic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
918077064 1:181178482-181178504 CAGTGGGAGGGGGTGGTGAAGGG + Intergenic
918614230 1:186525987-186526009 CTGTGGGAGGAGCAGGGGAAGGG - Intergenic
918799356 1:188953123-188953145 CTGTGGATGGGGTGAGTGAAGGG + Intergenic
919090748 1:192976685-192976707 CTGGGGAAGGGGAATGTCAAAGG - Intergenic
920273648 1:204787289-204787311 TGGTGGAAGGGGAAGGGGAAGGG - Intergenic
921164139 1:212494036-212494058 GGGTGGAAGGGGTAGAGGAATGG - Intergenic
921540306 1:216406028-216406050 CTGTGGCAGCAGTAGGGGAAGGG + Intronic
922069070 1:222173549-222173571 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
922844795 1:228676212-228676234 CTTTGGAAGGTCAAGGTGAAAGG - Intergenic
923211976 1:231811662-231811684 CTGAGGATTGGGCAGGTGAAAGG + Intronic
923601579 1:235407790-235407812 TTGTTGAAGGGGTAGTTGAGGGG + Intronic
923732069 1:236561354-236561376 CTGTGGAAGGTTTCAGTGAATGG - Intronic
924064829 1:240210224-240210246 CTGTGGAATGTGTAGGTGGCAGG + Intronic
924432287 1:244007455-244007477 ATGTGGCAGGGGTGGGTGACAGG - Intergenic
924464809 1:244290400-244290422 CTGAGGAAGGGTTGGGTGCATGG - Intergenic
1063313387 10:4978119-4978141 CTGGGAAAGGGGCAGGTGACAGG + Exonic
1063314565 10:4989598-4989620 CTGGGAAAGGGGCAGGTGACAGG - Exonic
1067124045 10:43500251-43500273 CTTTGGAAGGGCTAGGTGAAAGG - Intergenic
1067713622 10:48670788-48670810 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1069620176 10:69832626-69832648 CTGTGGACAGGGCAGGGGAAGGG + Intronic
1070039707 10:72763907-72763929 GTGTGGAAGGGGAGTGTGAAGGG - Intronic
1070199151 10:74186282-74186304 CTGTGGAAAGGAAAGGAGAAGGG - Intronic
1071060349 10:81563429-81563451 CTGTGGAGGGGGTGTGGGAAGGG - Intergenic
1071396933 10:85233296-85233318 CTGTGGATGGGGGTGGTGAGCGG + Intergenic
1072686445 10:97540046-97540068 CTGAGGAAGGGGGAGGGGCATGG + Intronic
1072914852 10:99531430-99531452 ACCTGGAAGGGGCAGGTGAAAGG - Intergenic
1073354543 10:102843501-102843523 GTGGGGAAGGAGTAGGCGAAGGG + Intergenic
1073502142 10:103949870-103949892 CAGTGGAAGGGGCAGGGGAAAGG + Intergenic
1073744114 10:106445891-106445913 CTTTGGAAGGCCTAGGTGGATGG - Intergenic
1074813600 10:117127968-117127990 CTGAGGAAGGGGAACGTGATTGG - Intergenic
1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG + Intergenic
1075603551 10:123788324-123788346 CTGGTGAAGGGGGAGGTAAAAGG - Intronic
1075902245 10:126052248-126052270 CTGTGGAAGGGCTAAGAAAATGG + Intronic
1076483337 10:130799371-130799393 CTTTGGGAGGTCTAGGTGAACGG + Intergenic
1077616115 11:3675300-3675322 TTCTGGAAGGGGTAGATGGAGGG + Exonic
1077852367 11:6085450-6085472 CTGGGGAAGGGGTGAGTGAGGGG - Intergenic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078355743 11:10630185-10630207 CTCTGGATGAGGTGGGTGAACGG + Intronic
1079562719 11:21842752-21842774 CCTTGGAAGGGGTAAGTGAGAGG + Intergenic
1079709797 11:23666771-23666793 CTGGGGTAGGGGTAAGTGAAAGG - Intergenic
1080525605 11:33113810-33113832 CTTTGGAAGGCTGAGGTGAATGG + Intronic
1080694862 11:34594693-34594715 CTGAGGCAGGGGTAGGGGTAGGG - Intergenic
1081126248 11:39326646-39326668 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
1081268956 11:41060981-41061003 GTGTGGAGGGGGGAGGGGAAGGG - Intronic
1081730438 11:45368425-45368447 CTGTAGAATGGGTGGGTGAATGG - Intergenic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1082017269 11:47499682-47499704 CTGGGGAAGGGGTAGGGAAAGGG + Intronic
1082715156 11:56603241-56603263 CTGTGGAAAGGGAAGGGGAGAGG - Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1083248848 11:61451816-61451838 CTGAAGAAGGGATAAGTGAATGG + Intronic
1083842323 11:65311544-65311566 CTGTGGTAGGGGTGAGTAAAGGG - Intergenic
1083929603 11:65833565-65833587 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1084147371 11:67272240-67272262 CTGTGGAAGAGCTGGGTGCAGGG - Intronic
1084484671 11:69440924-69440946 CTGTGGAAGGCGGAGAAGAAGGG + Intergenic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1086131591 11:83407458-83407480 CTGTGGCCGGGGGAGATGAAGGG + Intergenic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1086768915 11:90736094-90736116 ATGTGCAGGGAGTAGGTGAAGGG - Intergenic
1087712332 11:101567841-101567863 CTTTGGAAGGGGTCTGTGAGTGG - Intronic
1087830207 11:102811252-102811274 ATGTGGAAGGGGGATGTGTAGGG + Intergenic
1089159076 11:116424004-116424026 CTGAGGAACAGGTAGGGGAAAGG - Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089437771 11:118485430-118485452 GGGTGGCAGGGGGAGGTGAAGGG + Intronic
1089602985 11:119626565-119626587 CAGGGGAAGGGGGAGATGAAAGG + Intronic
1089667980 11:120032411-120032433 CTGCTGAAGGGGTAGGTGGCAGG - Intergenic
1089759301 11:120711385-120711407 CTGTGGCAGAGGCAGGTGATGGG - Intronic
1090049223 11:123362751-123362773 TTGGGGAAGGGGTAGGGGATAGG + Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090383781 11:126344817-126344839 CTGTGGAAGGGGTATGGGAGGGG - Intronic
1091052163 11:132382450-132382472 CTGTGGAAGGAAGAGGTGCATGG + Intergenic
1091780829 12:3213644-3213666 CTGAGAAAGGGACAGGTGAAGGG - Intronic
1092202801 12:6597024-6597046 CTTTGGAAGGAGGAGGTGAGCGG + Intronic
1092204581 12:6607214-6607236 CTGAGGAAGGGGCGGGTGACGGG + Intronic
1092465841 12:8730671-8730693 TTGTGGAAAGGGTAGGGCAAGGG + Intronic
1092482105 12:8869016-8869038 CTGTGGAAAAGGTAGGAAAAGGG - Intronic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1094295153 12:28897512-28897534 CAGTTGAAGTGGAAGGTGAAAGG - Intergenic
1094778067 12:33755489-33755511 ATCTGGAAGGACTAGGTGAAAGG + Intergenic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1096627060 12:52902480-52902502 CTGAGGCAGGGGCAGGAGAATGG - Intronic
1096781054 12:53992333-53992355 CTATAGAAGGGGAAGGGGAAAGG - Intronic
1097185127 12:57192659-57192681 CTGTGGGAGGGCCAGGTGCATGG - Intronic
1097821263 12:64131276-64131298 TTGTGGAAGAGGTATGTGGATGG - Intronic
1098022646 12:66171600-66171622 TTGTTGAATGGATAGGTGAATGG + Intergenic
1098176668 12:67799286-67799308 GTGTGGAAAGGGGAGGAGAAAGG - Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099210391 12:79779958-79779980 CTTTGGGAGGCCTAGGTGAAAGG + Intronic
1100277360 12:93083219-93083241 CTTTGGAAGGTGTAGGTGGGTGG - Intergenic
1101618613 12:106361883-106361905 CTGTGGAAAGGGAATGTGAGGGG + Intronic
1102054186 12:109883849-109883871 TTGATGAAGGGGTAGATGAATGG - Intergenic
1102081639 12:110103120-110103142 CTTTGGAAGGCCAAGGTGAAAGG - Intergenic
1102543322 12:113637954-113637976 CTGGGGAAGGGGTGGGGGTAGGG - Intergenic
1103225242 12:119281871-119281893 GTGTCGAGGGGGTAGGTGGAGGG - Intergenic
1104001698 12:124864183-124864205 TGGGGGAAGGGGTAGGAGAAAGG - Intronic
1104485077 12:129144252-129144274 CTGTGGTAGAGGTAAGTTAATGG + Intronic
1105731911 13:23226015-23226037 GTGTGGCAGAGGTAGGAGAATGG - Intronic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1105870970 13:24505991-24506013 CTGTAGGAGTGGGAGGTGAAAGG - Intronic
1105906516 13:24816141-24816163 CTTTGGGAGGGTAAGGTGAAAGG - Intronic
1106182024 13:27377793-27377815 CTTTGGAAGGCTTAGGTGAGAGG + Intergenic
1106237104 13:27872369-27872391 CTTTGGAAGGCTGAGGTGAATGG - Intergenic
1106366225 13:29083479-29083501 CTGTTGAAGTGGGAGCTGAATGG + Intronic
1106684871 13:32047995-32048017 ATGTAGAAAGGGTAGGGGAAGGG - Intronic
1107364572 13:39656131-39656153 CTCTGGATGGGATTGGTGAACGG + Intronic
1108119762 13:47172000-47172022 CCATGGAAGGAGTAGGGGAATGG + Intergenic
1108478928 13:50847340-50847362 CTGTAGAAAGGTTAGGTGAATGG - Intergenic
1109548535 13:63860798-63860820 CAGTGGGAGGGGTAGGTGGGTGG - Intergenic
1110333566 13:74300481-74300503 GTGTGGTAGGGGTGGGTGGATGG + Intergenic
1110597682 13:77337171-77337193 CTGTAAAAGAGGTAGGTGAGTGG + Intergenic
1110903787 13:80860230-80860252 CTGTGGGAGGAGCAGGTGAGAGG - Intergenic
1111057711 13:82972392-82972414 TTGGGGAAGGGGTATGTGGATGG - Intergenic
1111165763 13:84455524-84455546 CTGTGGCTGGTGTAGGTGATGGG + Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1111475052 13:88735136-88735158 CTTTGGGAGGGCAAGGTGAATGG + Intergenic
1112464929 13:99635474-99635496 ATGTGGAAGGGGAGGCTGAATGG - Intronic
1113770336 13:112904174-112904196 CTGGGGTAGGGGTAGGTGTTAGG + Intronic
1113783008 13:112987232-112987254 CGCTGGAAGGGGCAGGTGGAGGG - Intronic
1114816485 14:25964918-25964940 CTGTGAAAGGGAAAGTTGAAGGG - Intergenic
1115465210 14:33707754-33707776 CTCTGGAAGGGCTAGAGGAAAGG - Intronic
1116265209 14:42679566-42679588 CTGTGGAAGGCTGAGGTGTAAGG - Intergenic
1116785812 14:49287707-49287729 CTGTGGAAAGGGTAGGGGAGAGG - Intergenic
1116840943 14:49820628-49820650 CCGTGGAAGGGGGAGGAGAGAGG - Intronic
1117302286 14:54441400-54441422 CTGTGGCCGGGGGAAGTGAATGG - Exonic
1117390789 14:55260489-55260511 CTTTGGAAGGTCTAGGAGAAAGG - Intergenic
1117409510 14:55438557-55438579 ATGGGGAAGGGGAAGGGGAAGGG - Intronic
1117487049 14:56208423-56208445 CACTGGAAGGTGTAGGAGAATGG + Intronic
1117650671 14:57901522-57901544 GTGTGGGTGGGGTAGGGGAAGGG + Intronic
1117744108 14:58850382-58850404 CTTTGGAAGGGATAAGAGAATGG - Intergenic
1117974516 14:61283899-61283921 GTGTGGAAAGGGAAGGAGAAAGG + Intronic
1118457428 14:65957732-65957754 CTGTGCAAGGGCTAGGGGATGGG - Exonic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1119441353 14:74630900-74630922 CTGTGGAGGGGCCAGGTGTAGGG + Intergenic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120642354 14:87030440-87030462 CTGGGGAAAGGACAGGTGAAAGG - Intergenic
1120742087 14:88119398-88119420 CTGTGGCAAGGGTAGGAGCATGG - Intergenic
1120775378 14:88430134-88430156 CGGTGGAAGGGGTAGAAGAAAGG + Intronic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121347191 14:93144812-93144834 CTGTGGAAGGCCTAGGCGGAAGG - Intergenic
1121505249 14:94472246-94472268 CTGAGCAAGGGGTAGGTGAGTGG - Intronic
1122119655 14:99545311-99545333 ATGTGGAGGGGGCAGCTGAATGG + Intronic
1122172906 14:99891434-99891456 TTTTGGAGAGGGTAGGTGAAGGG - Intronic
1122539017 14:102486543-102486565 CTGTGGAAGGGGCAGTTTCATGG - Intronic
1123093182 14:105751198-105751220 CTGAGGAAGGGGTGGGGGCAGGG - Intergenic
1123102059 14:105811019-105811041 TGGTGGAAGGTGAAGGTGAAGGG + Intergenic
1124379037 15:29149256-29149278 CTTTGGAAAGGTTCGGTGAAAGG - Intronic
1124689803 15:31812331-31812353 CCTTGGAAGGCGTAGCTGAAGGG - Intronic
1124782886 15:32652368-32652390 CTGTGGAAGGATTGGGGGAAGGG + Intronic
1125181366 15:36883735-36883757 CGGTGGAAGGAGTCAGTGAAAGG + Intergenic
1125310306 15:38372018-38372040 CTGGGGCTGGGGTAGGGGAATGG - Intergenic
1125507542 15:40275734-40275756 CTGTGGAAGGGGCAGAGGATTGG - Intronic
1125597440 15:40895886-40895908 CTGTGGAAGAGACAGGTGAAGGG - Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126459522 15:48900262-48900284 CTTTGGAAGGGCTAGGTGGGAGG + Intronic
1126490035 15:49226288-49226310 CTGAGGGAGGGGTTAGTGAAGGG - Intronic
1127172940 15:56322448-56322470 GTGTGGAAGGAGTGGGTGAGAGG + Intronic
1127293409 15:57590279-57590301 TTTTGGAAGGGATAGGTGGATGG + Intergenic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128802913 15:70508364-70508386 CTCTGGAAGGGGCAGGGGAGGGG + Intergenic
1129616560 15:77103611-77103633 GAGTGGAGGGGGTAGGTGAATGG + Exonic
1129703686 15:77782683-77782705 CTGGGGAAGGGGTTGGAGAGTGG - Intronic
1130031269 15:80316719-80316741 CTGAGGAACAGGTGGGTGAAGGG - Intergenic
1130032989 15:80332785-80332807 CATTGGAAAGGATAGGTGAAAGG - Intergenic
1131668816 15:94597893-94597915 TTGTGGAAGTGGTGGGTGGATGG - Intergenic
1131698418 15:94905522-94905544 CTGTGGAAAGGATCGGTGGACGG + Intergenic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1132826471 16:1907900-1907922 CTGTGGAGAGGGTGGGTGCAGGG + Intergenic
1132941691 16:2511672-2511694 CAGTGGAAGGTGGTGGTGAAGGG + Intronic
1132981623 16:2741189-2741211 CTGAGGCAGGGGTTGGTGCAGGG - Intergenic
1133192939 16:4147652-4147674 CTGTGGAAGGGGCCCATGAATGG - Intergenic
1133439942 16:5812703-5812725 CTTTGGAAGGCAGAGGTGAAAGG - Intergenic
1134219889 16:12345628-12345650 CTGTGGAGGAGGTGGATGAATGG + Intronic
1135012671 16:18896008-18896030 CTTTGGAAGGTGTATGTGATTGG + Intronic
1135319585 16:21483588-21483610 CTTTGGAAGGTGTATGTGATTGG + Intergenic
1135372422 16:21915077-21915099 CTTTGGAAGGTGTATGTGATTGG + Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135439364 16:22455627-22455649 CTTTGGAAGGTGTATGTGATTGG - Intergenic
1135489516 16:22897050-22897072 CTTTGGGAGGGCTAGGTGACTGG - Intronic
1135490017 16:22900951-22900973 CTGTCGCAGGAGCAGGTGAAGGG + Intronic
1136075933 16:27817232-27817254 CTGTGGCAGGGGTGGGTGTCAGG + Intronic
1136116064 16:28095562-28095584 CTGAGGAAGGGGATGGGGAAAGG - Intergenic
1136329817 16:29565307-29565329 CTTTGGAAGGTGTATGTGATTGG + Intergenic
1136444445 16:30305011-30305033 CTTTGGAAGGTGTATGTGATTGG + Intergenic
1136751268 16:32637941-32637963 CTGGGCAGTGGGTAGGTGAAGGG + Intergenic
1136751371 16:32638322-32638344 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1137709869 16:50559120-50559142 CTGTGGAATGGGTAGAGTAATGG + Intronic
1137899115 16:52245966-52245988 CTGGGGAAGGGTTGAGTGAAGGG + Intergenic
1138271151 16:55696736-55696758 CTGTGGAAGGCTGAGGTGGAAGG + Intronic
1138299642 16:55915400-55915422 CAGTGGAAGGGGGTGGAGAAGGG + Intronic
1139117936 16:63979573-63979595 CTGTTGAAGGGTTGGGGGAAAGG - Intergenic
1139924459 16:70478528-70478550 CTGCGGACGGGGCAGGAGAAGGG - Intronic
1140110341 16:71998692-71998714 CTTTGGAAGGTGGAGGTGGATGG - Intronic
1140183197 16:72741408-72741430 CTTTGGGAGGTGTAGGTGGAAGG - Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140552624 16:75883387-75883409 CTTGGGCAGGGGCAGGTGAAGGG + Intergenic
1140814486 16:78608606-78608628 CTGTGGAAGGGTCAAGTGCAGGG + Intronic
1141383123 16:83593873-83593895 CTGTGGTAGTGGTAGGTGCTGGG + Intronic
1141909680 16:87050196-87050218 CTTAGGAAGGGGTCGGTGGACGG - Intergenic
1142388820 16:89784707-89784729 TTGGGGAAGGGGAAGGGGAAGGG + Intronic
1142411659 16:89920141-89920163 CTGTGGAAGGCGTAGATGAGGGG - Exonic
1203053402 16_KI270728v1_random:897196-897218 CTGGGCAGTGGGTAGGTGAAGGG + Intergenic
1203053505 16_KI270728v1_random:897577-897599 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1142748184 17:1971131-1971153 GTGTCGAAGGGGGAGGTGATTGG + Intronic
1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG + Intronic
1142881667 17:2886706-2886728 CTGGGGAATGGGTAGTTCAAGGG - Intronic
1142942749 17:3396512-3396534 CTTTGGAAGGCCTAGGTGAGCGG + Intergenic
1143496672 17:7316367-7316389 CTTTGCAAGGGGGAGGTGATGGG - Intronic
1143621782 17:8084911-8084933 CTCTGGCAGGGGTGGGTGCAAGG + Intronic
1143904373 17:10197870-10197892 CAGTGGCAGGGGCCGGTGAAGGG - Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144235648 17:13258019-13258041 CAGTGGAGGGGGAAGGGGAAGGG - Intergenic
1144342620 17:14322725-14322747 CTGTGTTAGGGGTCAGTGAATGG - Intronic
1144847818 17:18229203-18229225 CTGTGAAAGGGGCAGGGGAGCGG + Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145010556 17:19365322-19365344 CTGTGGAGAGAGGAGGTGAAGGG + Intronic
1146497792 17:33338279-33338301 CTCTGGAAGGGCAAGGAGAATGG + Intronic
1146711740 17:35047993-35048015 CTGTGGAAGGCCAAGGTGAATGG - Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147624699 17:41892495-41892517 CTGGGGAAGGGGAAGCTGAGGGG + Intronic
1148020490 17:44549969-44549991 CTGTGACGGGGGAAGGTGAAAGG + Intergenic
1148587691 17:48792431-48792453 GTGTGGAAGGAGGAGGTGCAGGG + Intronic
1148700170 17:49582324-49582346 CAGTGGATGGGGAAGGTCAACGG - Intronic
1148741932 17:49897915-49897937 CTAGGGAAGGGGAAGGTGAGAGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1148846388 17:50532513-50532535 CTGTTGAAGAGGCAGGGGAAGGG + Intergenic
1148848687 17:50543568-50543590 CTGAGGTGGGGGTAGGGGAAGGG + Exonic
1149270601 17:54973119-54973141 TTGGGAAAAGGGTAGGTGAAAGG - Intronic
1149835214 17:59906365-59906387 CTGTCGAAAGGGAAGGGGAAGGG - Intronic
1150177477 17:63075760-63075782 CTTTGGGAGGGTGAGGTGAATGG - Intronic
1150198070 17:63321912-63321934 CTGTGGAAGAGAAGGGTGAAGGG - Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1151064490 17:71134714-71134736 CTGTGGCATGGGTAGGGCAATGG - Intergenic
1151278048 17:73050790-73050812 CTGGGGATGGGGGAGGTGAAAGG + Intronic
1151343476 17:73486807-73486829 CTGGGGAAGGGGGCAGTGAAGGG + Intronic
1151753742 17:76058500-76058522 CTGTGGGAGGCTGAGGTGAAAGG - Intronic
1152240285 17:79157355-79157377 CTGTGGAAGGGGTGCATGGACGG - Intronic
1152417336 17:80171146-80171168 GAGGGGAAGGGGAAGGTGAATGG - Intronic
1153780715 18:8493010-8493032 CTTTGGAAGGCAGAGGTGAAGGG + Intergenic
1154225704 18:12501715-12501737 CTTTGGAAGGCGGAGGTGAGAGG + Intronic
1156231810 18:35160573-35160595 CTTTGGAAGGCTGAGGTGAAAGG - Intergenic
1157053526 18:44198147-44198169 CCTGGGAAGGGGTAAGTGAAGGG + Intergenic
1158157042 18:54437637-54437659 CTGTGGAAGAGAGAGGTAAAAGG + Intergenic
1158178384 18:54683802-54683824 TGGTGGAAGGGGAACGTGAAGGG + Intergenic
1158198792 18:54917118-54917140 CTGAGGAAAGGGGAAGTGAATGG + Intronic
1158283679 18:55855009-55855031 CTGTGGAAGGAGGTGGTGATGGG + Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161232146 19:3179702-3179724 CTGCGGAAGGAGTAGATGATGGG - Exonic
1161292162 19:3500435-3500457 CTGTGGATGGGGCGGGTTAAGGG - Intronic
1161519479 19:4715733-4715755 ATGTGGGAGGTGCAGGTGAAAGG + Intronic
1161698194 19:5782015-5782037 CTGGGGAAGGGGTAGGCTGAAGG + Intergenic
1162499338 19:11042581-11042603 CTGTTGGAGGGGAAAGTGAAGGG + Intronic
1163425830 19:17240560-17240582 CTGTGAAAGGGAGGGGTGAAAGG + Intronic
1164289680 19:23856064-23856086 GTGGGGGAGGAGTAGGTGAAGGG + Intergenic
1164569637 19:29363531-29363553 CTGGGGTAGGAGTAGGGGAATGG + Intergenic
1165049808 19:33134235-33134257 CTGTGGTGGGGGTAGCGGAATGG + Intronic
1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG + Intronic
1165159671 19:33808628-33808650 CAGTGGAAGGGGTGTGTGCAGGG + Intronic
1165197321 19:34114732-34114754 CTTTGGGAGGCGAAGGTGAAAGG + Intergenic
1165451461 19:35886209-35886231 CTGTGGAGCGGGTATGAGAATGG + Intergenic
1165780360 19:38429940-38429962 CTTTGGGAGGTCTAGGTGAAAGG - Intergenic
1166274476 19:41742837-41742859 CTGGTGATGGGGGAGGTGAAAGG + Intronic
1166968625 19:46547020-46547042 CTTTGGAAGGCCCAGGTGAATGG - Intronic
1166992194 19:46699233-46699255 CTGAGGAAGTGGCAGTTGAAGGG - Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167339142 19:48904476-48904498 CTGTGGGAGGGGTACGTGCTGGG + Intronic
1167585147 19:50370267-50370289 CTGGCGAATGGGTAGGTAAAAGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167849957 19:52193866-52193888 CTTTGGAAGGCCAAGGTGAAAGG + Intronic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
925459853 2:4051540-4051562 CTTTGGAAGGTGGAGGTGGAAGG + Intergenic
925886044 2:8394432-8394454 CTGGGCAGGGGGAAGGTGAAGGG - Intergenic
927699644 2:25259717-25259739 CTGGAGAAGGGGTGGGGGAAGGG - Intronic
927772050 2:25871348-25871370 CTGTGGATGGGGAAGCAGAAAGG + Intronic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
929033912 2:37672647-37672669 CTGGGGAAGGAGTAGGCGACAGG + Intronic
929665664 2:43831999-43832021 CTGGGGGAGGTGTATGTGAACGG - Exonic
929825327 2:45305537-45305559 CTGAGGAAGGGCTTGGGGAAAGG - Intergenic
929863122 2:45696197-45696219 CTTTGGGAGGCTTAGGTGAAAGG - Intronic
930017167 2:46978897-46978919 CTGAAGAAGGGGTAGGTCACTGG + Exonic
930320480 2:49848408-49848430 CTGTTGGAGGGGTAGGGGGAGGG - Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
932940673 2:76161119-76161141 ATGTGGAAGGGATAGGAGAGAGG + Intergenic
934751752 2:96798296-96798318 TTGTGGAATGGGAAGGAGAAGGG + Intronic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
935619542 2:105116883-105116905 CTTTGGAAAGGGTAGGAGCAGGG - Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
935838367 2:107079750-107079772 CTATGGACGGGGGAGGTGAGAGG + Intergenic
936770843 2:115911250-115911272 CTGTGAGTGGGGAAGGTGAAAGG + Intergenic
937144812 2:119635499-119635521 CTGTGGATGGGTTGGGTGGATGG + Intronic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938111243 2:128567114-128567136 CTTTGGGAGGCGTAGGTGAGTGG + Intergenic
938428355 2:131210318-131210340 CTGTGGAAGGGGTGGTTGGGGGG + Intronic
938945192 2:136206049-136206071 CTGGGGAAAGGGTAGAAGAATGG - Intergenic
939998062 2:148938660-148938682 CTGTGGCTGGGGAGGGTGAAGGG + Intronic
940082028 2:149813754-149813776 CTGTATAAGGAATAGGTGAAAGG + Intergenic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941080463 2:161054913-161054935 CTGAGGAAAGGGGAGGTGATGGG + Intergenic
941260188 2:163287866-163287888 CTTTGGAAGGGCTAGGTGGGAGG - Intergenic
943552748 2:189360766-189360788 CTGTTGGAGGGGTGGGGGAAGGG - Intergenic
943746049 2:191463711-191463733 ATGTAGAAGGGGTAGCTGGATGG - Intergenic
944132945 2:196366555-196366577 CTGTGGTGGAAGTAGGTGAAGGG - Intronic
944412307 2:199457146-199457168 GGGTGGCAGGGGGAGGTGAAAGG + Intronic
945011483 2:205468631-205468653 CTGAGGAAGAGGTAGGGGAATGG + Intronic
946991877 2:225341495-225341517 ATATTGAAGGGGTAGGTAAAGGG - Intergenic
947171387 2:227316030-227316052 CTTTGGGAGGCCTAGGTGAATGG + Intergenic
948214926 2:236221571-236221593 CTGGGGAGGTGGAAGGTGAAAGG - Intronic
1168732938 20:103293-103315 CTGGGGAAGGGGTAAGTAAGGGG + Intergenic
1168760085 20:344627-344649 CTGTAGAAGGCGAAGGGGAAGGG - Intergenic
1169249595 20:4050111-4050133 CTGTGGAAGGGGTGAGTTTAGGG - Intergenic
1169700469 20:8440634-8440656 CTTTGGAAGGGTTGGGGGAAGGG + Intronic
1172053773 20:32139897-32139919 CTGAGGAAGGGGTACTTGAAAGG - Intronic
1172394948 20:34595641-34595663 TTGAGGAGGGGGTAAGTGAAGGG - Intronic
1172845780 20:37929305-37929327 CTGTGGCAGGAGTAGGAGCAGGG + Intronic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1173582771 20:44159316-44159338 AAGTGGAATGGGTAGGGGAATGG + Intronic
1173868632 20:46328603-46328625 CTGTGGAAGGAGGAGAGGAATGG - Intergenic
1174469488 20:50745748-50745770 CTTTGGAAGGGCGAGGTGAGAGG - Intronic
1174645737 20:52084134-52084156 GTGAGGAAGGTGTACGTGAAGGG - Intronic
1175415250 20:58796725-58796747 GTGTGGAAGGGGCAGGTGTCTGG - Intergenic
1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG + Intronic
1177358660 21:20040655-20040677 CTCTCTAAGGTGTAGGTGAAAGG - Intergenic
1178436942 21:32567929-32567951 CTGAGGAAAGGGTAAGTGAAGGG - Intergenic
1178509198 21:33188609-33188631 CTTTGGAAGGCTGAGGTGAACGG - Intergenic
1180002636 21:45002158-45002180 CTGGGGAGGGGGTTGGGGAAGGG + Intergenic
1180956688 22:19744430-19744452 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1181050137 22:20234477-20234499 CTGTTGAAGGAGTCGGTGAACGG + Intergenic
1181626945 22:24128734-24128756 CTGAGGTATGGCTAGGTGAAGGG + Intronic
1182080259 22:27523863-27523885 CTGTGAAATGGGTATGTAAATGG - Intergenic
1182145336 22:27993768-27993790 GTGTGGAAGGGGTTGGTTTAGGG - Intronic
1182240159 22:28909834-28909856 CTTTGGAAGGCCGAGGTGAATGG - Intronic
1182342232 22:29632638-29632660 TTGTGGAAGAGGTGGGTGAGCGG + Intronic
1182395655 22:30034019-30034041 CTGTGGGAGGAGTCGGGGAAAGG + Intergenic
1182570658 22:31235255-31235277 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1183828219 22:40404838-40404860 CTGTGGAAGGGCTTGGAGATGGG + Intronic
1183867220 22:40713369-40713391 CTGTGGAAGGTAGTGGTGAAGGG + Intergenic
1184972274 22:48033209-48033231 CTTTGGAAGGGTGAGGTGGATGG - Intergenic
949638992 3:6014145-6014167 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
950366400 3:12488149-12488171 CTGAGGGAGGGGAAGGTGAGTGG - Intronic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
950559140 3:13711917-13711939 CTGTGGTAGGGGCTTGTGAAGGG + Intergenic
951160094 3:19408291-19408313 GGGTGGAAGGGGAAGGTAAAGGG + Intronic
951758303 3:26117494-26117516 TTGGGGAAGGGGTGAGTGAAGGG + Intergenic
952144262 3:30514656-30514678 CTTTGGAAGGCTGAGGTGAAAGG - Intergenic
952331336 3:32367032-32367054 CAGAGGAAGGGGTAGGGGAAAGG - Intronic
953211731 3:40881308-40881330 CTTTGGAAGGCCTAGGTGGATGG - Intergenic
953535714 3:43775235-43775257 CTTTGGAAGGGGTCAGAGAAGGG + Intergenic
953809560 3:46100383-46100405 CTGTGGAAGGGGGTGCTGATGGG + Intergenic
954072073 3:48150363-48150385 CTTTGGGAGGCCTAGGTGAATGG - Intergenic
954326790 3:49868424-49868446 CTGAGGCATGGGGAGGTGAAGGG - Intronic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
954529677 3:51308145-51308167 CTGTGGAGGTGGGAGGGGAAGGG + Intronic
954802766 3:53196661-53196683 CCGAGGAAGGGGCAGGTGCATGG - Intergenic
955350402 3:58189270-58189292 CTGGGGGTGGGGTGGGTGAAGGG - Intergenic
955356844 3:58238413-58238435 CTGGGGAAAGGGAAGCTGAAAGG - Intronic
955360371 3:58268987-58269009 GTGTGGAAGGGGTGAGGGAAAGG + Intronic
955868545 3:63411933-63411955 CAGTGGATGGGGTAGAGGAATGG + Intronic
956376844 3:68622243-68622265 CTGAAGAAGGAGTATGTGAATGG - Intergenic
959043142 3:101441618-101441640 CTGTGGCCGAGGTAGGTGACAGG - Intronic
959660654 3:108864317-108864339 CCGTTGAAGGGGCAGGTCAAAGG - Intergenic
960316347 3:116182572-116182594 GTGAAGAAGGGGTAGATGAAAGG + Intronic
960535657 3:118812137-118812159 CTTTGCAAAGGGTAGGTGGATGG + Intergenic
960628780 3:119707194-119707216 ATGTGGAGGGGGTAGGGGATAGG - Intronic
960692513 3:120361654-120361676 CTTTGGAAGCGGTAGAAGAAAGG - Intergenic
960900655 3:122551111-122551133 ACCTGGAAGGGGCAGGTGAATGG - Intronic
961384205 3:126515483-126515505 GAGTGGAAGGGGTAGGTGGTAGG - Intronic
961531318 3:127542143-127542165 CTGTGGAAGGGCCAGGTGCTGGG - Intergenic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
963219194 3:142788223-142788245 CTGTGGCAGGAGTAGATGGAGGG + Intronic
963461688 3:145622456-145622478 CTGTGGAATGAAGAGGTGAAAGG - Intergenic
963582714 3:147147170-147147192 CTGGGGAAGGGGTGAGTGAAGGG + Intergenic
963980065 3:151527704-151527726 CTTTGGAAGGCTGAGGTGAAAGG + Intergenic
964881499 3:161428356-161428378 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
964966292 3:162497158-162497180 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
965072627 3:163934953-163934975 CAGTGGAAGGTGTATCTGAAGGG + Intergenic
965242312 3:166217669-166217691 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
969121328 4:4913498-4913520 CTGGGGAAGGGGGAGGGAAAGGG + Intergenic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969509721 4:7610838-7610860 CTGTGGACGGGGATGGGGAAGGG + Intronic
969579270 4:8054574-8054596 CTGAGGAGGGGGTATTTGAAGGG + Intronic
970392633 4:15631064-15631086 CTGTGGTGGGGGTAGGGGACTGG - Intronic
971100928 4:23465792-23465814 CTGGGGAAGAGGTATGTGAATGG - Intergenic
971500373 4:27312151-27312173 CTGTGGAAGGGGTGGATTATCGG - Intergenic
971795597 4:31223458-31223480 ATGTGGAAGGGGGCGGTGATGGG - Intergenic
971817312 4:31505702-31505724 TTGGGGAAGAGGTATGTGAATGG + Intergenic
972109552 4:35541135-35541157 CTGGGGAAGGGGTGAGTGAAGGG + Intergenic
972190825 4:36588527-36588549 CAGGGAAAGGGGTAGGTGTAGGG - Intergenic
972661360 4:41119689-41119711 CTCTGGACAGGGTATGTGAAAGG - Intronic
973756303 4:54077424-54077446 CAGTGGAAAGGGTATATGAATGG + Intronic
974605625 4:64146488-64146510 GTGGGGGAGGAGTAGGTGAAGGG + Intergenic
975228172 4:71899211-71899233 CTGTTGAAGGGGTAGATGGTGGG - Intergenic
976111825 4:81683615-81683637 CTGTGGAAAGCCTAGGTGAGCGG - Intronic
976753802 4:88477404-88477426 GAGGGGAAGGGGAAGGTGAAGGG + Intronic
978062058 4:104351107-104351129 CCAAGGAAGGGGTAAGTGAAAGG + Intergenic
979249685 4:118553196-118553218 GTGTGGAAGGGGTCAGTTAAAGG - Intergenic
980478633 4:133355821-133355843 TTCTGGAAGGGGTGGGGGAAGGG - Intergenic
981835089 4:149044569-149044591 TTGAGGAAGGGGTATGTGGATGG + Intergenic
981980781 4:150788339-150788361 CTTTGGGAGGAGTAGGTGGATGG - Intronic
982134401 4:152259497-152259519 CTGTGGCAGGGGGAGGGGCATGG - Intergenic
984783856 4:183550929-183550951 CTTTGGAAGGGCTAGGTGGGTGG + Intergenic
985269423 4:188179748-188179770 ATGTGGGAGGGGTAGGATAAGGG + Intergenic
985690114 5:1304252-1304274 AAGTGGAAGGGGAAGGGGAAGGG - Intergenic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
986232494 5:5879365-5879387 CTCTGGCAGGGGTATGGGAATGG - Intergenic
986929883 5:12805100-12805122 CTGAGAAAAGGGTAGGGGAAGGG - Intergenic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
988735980 5:34021758-34021780 CTGTGGCAGGGTGAGGGGAAAGG + Intronic
989178418 5:38553095-38553117 CTGTGGCTGGAGTTGGTGAAAGG - Intronic
990984690 5:61630669-61630691 CTTTGGAAGGCCTAGGTGAGTGG - Intergenic
991063947 5:62406049-62406071 CTGTGGAGGTGGTAGGACAAGGG + Intronic
991605444 5:68396148-68396170 ATGAGGAAGGGGGAGGGGAAAGG + Intergenic
992162541 5:74016866-74016888 CAGTGTAAGGGGGAGGTGAATGG + Intergenic
992182943 5:74215580-74215602 CAGTGGAAGGGGCAGAGGAAAGG + Intergenic
992605074 5:78447865-78447887 GGGAGGAAGGGGTAGGGGAAGGG - Intronic
993978346 5:94511013-94511035 CTTTGGGAGGGATAGGTGATGGG + Intronic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
994675321 5:102814023-102814045 CTGTGGTAGGGGCAGGAGACTGG + Intronic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995214910 5:109584002-109584024 CATAGGAAGGGGTGGGTGAAAGG + Intergenic
995946012 5:117646812-117646834 CTGGGGAAGGGTTGGGTGGAGGG - Intergenic
996047903 5:118896853-118896875 CTTTGGCAGGGATGGGTGAAAGG - Intronic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
996396056 5:123015201-123015223 CTGTTGAATGGGTGGGTGGATGG + Intronic
997460250 5:134047096-134047118 CTTTGGGAGGGGCAGGAGAAAGG - Intergenic
997862015 5:137426925-137426947 CTCTGGAAGGAGAATGTGAATGG - Intronic
998461396 5:142312889-142312911 CTGGGGAGAGGGTAGGGGAAAGG - Exonic
999318027 5:150596665-150596687 CTGTGGGAGGGGTAGATCACTGG - Intergenic
999642808 5:153688961-153688983 CTTTGGGAGGCGGAGGTGAATGG - Intronic
999735922 5:154512958-154512980 CTGGGGGCGGGGTAGGGGAAGGG - Intergenic
999967615 5:156826397-156826419 CTGTGGATGGGGTAGGGCAAGGG - Intergenic
999972996 5:156883589-156883611 TGGTGTAAGGGGCAGGTGAAGGG - Intergenic
1000040922 5:157484709-157484731 CTGGGGAAGGTGGTGGTGAAGGG - Intronic
1000642984 5:163726744-163726766 GTGTGGGTGGGGTAGGGGAAAGG + Intergenic
1000711466 5:164585285-164585307 CTGAGGAAGGTGTAGATGAAAGG + Intergenic
1000999633 5:167993737-167993759 CTGTGGAAGGGATATGGGCAAGG - Intronic
1001855070 5:175003830-175003852 CTGTGGAAGGGAGAGGAGACTGG + Intergenic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1005824153 6:29622454-29622476 CAGTGGTAGGAGTGGGTGAATGG - Intronic
1006630041 6:35424380-35424402 GTGTGGAAGCAGTTGGTGAATGG + Exonic
1007398458 6:41590318-41590340 ATGAGGGAGGCGTAGGTGAAGGG - Exonic
1007980318 6:46148401-46148423 TTGTGGAAGAGGCAGCTGAAAGG + Intergenic
1008292612 6:49736329-49736351 CTGTGGAAGGAGTAGGCGGCTGG - Intronic
1008624920 6:53306189-53306211 CCGTGGAAAGGGGAGGAGAAAGG + Intronic
1009609182 6:65916881-65916903 CTTTGGAAGGCCAAGGTGAAAGG - Intergenic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010107860 6:72189940-72189962 CTGGGGAAGAGGTACGTGGATGG - Intronic
1010390639 6:75332736-75332758 CTGTGGGAGGTGTATGTGGAAGG - Intronic
1011237264 6:85231265-85231287 CGGTGGAAGGAGTTGGAGAAGGG - Intergenic
1011361235 6:86527024-86527046 CTTGGGAAGGGGTGAGTGAAGGG - Intergenic
1011626793 6:89289677-89289699 ATCTGGAAGGGGAAGGGGAAGGG + Intronic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012637186 6:101558566-101558588 ATGTGGTAGGGGTGGGTGTATGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013912054 6:115287688-115287710 CTGTGGTAGCAGTAGGAGAATGG - Intergenic
1014602724 6:123434941-123434963 CTGGGGAAGTTGTAGGTGGATGG - Intronic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1016245926 6:141980768-141980790 CTGTGGTAGGAGTATGTGTAAGG - Intergenic
1017352629 6:153459643-153459665 CTGAGGAAGGGGTAAGTGAAGGG - Intergenic
1018144870 6:160876801-160876823 CTGAGGAAGGGGTAAGTGAAAGG + Intergenic
1018726727 6:166618423-166618445 GTGTGGAAGGGGTATGGGTAGGG + Intronic
1020283552 7:6663813-6663835 ATGTGGAGGTGGGAGGTGAAGGG + Intergenic
1022527504 7:31048078-31048100 CTGTGAAAGGGGGTGGTAAATGG + Intergenic
1024265902 7:47606256-47606278 CTGTGGCAGGGGTGGGGTAAGGG + Intergenic
1024866186 7:53906975-53906997 TTGGGGAAGAGGTATGTGAATGG + Intergenic
1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG + Intronic
1027047708 7:75002167-75002189 CTTTGGGAGGTGGAGGTGAATGG - Intronic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1028113973 7:86976547-86976569 GTGTGGAGGGGGCAGGTGAGGGG - Intronic
1028622096 7:92836368-92836390 CTGTGGGTGGGGTAAGTGGAGGG - Intronic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029385288 7:100239481-100239503 CTTTGGGAGGTGGAGGTGAATGG + Intronic
1030019126 7:105255439-105255461 CTGGGGGGAGGGTAGGTGAAGGG + Intronic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030457377 7:109792421-109792443 TTGGGGAAGGGATATGTGAATGG - Intergenic
1030902399 7:115140615-115140637 TCGTGGAAGGGGAAGGAGAACGG - Intergenic
1031257487 7:119473058-119473080 CTGAGGAAAAGCTAGGTGAAGGG - Intergenic
1033293897 7:140114178-140114200 CCGTGGAAAGGGGAGGGGAAGGG - Intronic
1033447620 7:141436524-141436546 CTGTGGTGGGTGTTGGTGAAGGG + Intronic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1035105186 7:156436223-156436245 CTTTTGTAGGGGTAGGTGAGGGG - Intergenic
1035766140 8:2107214-2107236 CTGTGGGTGGGGTAGATGACGGG - Intronic
1037454213 8:19047507-19047529 ATGTGGAGGGGGTAAATGAATGG + Intronic
1037901515 8:22692026-22692048 CTGGGGCCGGGGTAGGTGAAGGG - Intronic
1037952431 8:23027911-23027933 CTGAGGAAGGGGGATGAGAAGGG + Intronic
1037963654 8:23117476-23117498 CTGAGGAAGGGGGATGAGAAGGG - Intergenic
1037967399 8:23145246-23145268 CTGAGGAAGGGGGATGAGAAGGG + Intronic
1038327219 8:26580165-26580187 CTGTGGAGGCAGGAGGTGAAGGG + Intronic
1040482898 8:47842259-47842281 CTGTGCTGGGGGTAGGGGAAGGG - Intronic
1040532971 8:48280867-48280889 GTGTGGAATGGGTGGGTGGATGG - Intergenic
1041617737 8:59928007-59928029 TTGTGTGAGGGGTAGGTGAGTGG + Intergenic
1041826225 8:62099180-62099202 CTGAGGAAGGGGTGAGTGAAGGG + Intergenic
1042432200 8:68720680-68720702 CTGTGATAGGGATAGGTAAATGG - Intronic
1043219694 8:77645022-77645044 CTATGGAAGGAGAAGGGGAAGGG - Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1043858190 8:85286013-85286035 CTGTGCAATGTGTGGGTGAAAGG - Intergenic
1044296920 8:90538601-90538623 CTTTGGAAGGAGTAAGAGAAAGG + Intergenic
1044434707 8:92148373-92148395 TTGGGGAAGGGGTATGTGGAGGG + Intergenic
1044603282 8:94026783-94026805 CTGGGGAAGGGGTAGGGGAATGG - Intergenic
1044633063 8:94297774-94297796 CTGGGGAAGAGGTATGTGAATGG - Intergenic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1045676667 8:104614999-104615021 CAGTGGTGGGGGTGGGTGAAGGG + Intronic
1045678013 8:104629592-104629614 CTTTGGGAGGCGGAGGTGAATGG + Intronic
1045758619 8:105575284-105575306 CTGTGGCAGGGTTTTGTGAAAGG + Intronic
1047259699 8:123244472-123244494 CTGTTGAATGGATGGGTGAATGG + Intronic
1047304627 8:123642831-123642853 CTGTTGATGGGTTATGTGAAGGG + Intergenic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1049011573 8:139890993-139891015 CCGTGGACAGGGTAGGGGAATGG - Intronic
1049359816 8:142207140-142207162 CTGGGGAATGGATGGGTGAATGG + Intergenic
1049532890 8:143164888-143164910 CTTTGGGAGGCCTAGGTGAAAGG + Intergenic
1049672039 8:143874166-143874188 GTGTGGAAGGGGTTGGCGCAGGG - Intronic
1049926669 9:415638-415660 CTGTGGAGAGGGTAGGCCAATGG - Intronic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050888656 9:10796111-10796133 CTGGGGAAGAGGTATGTAAATGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051743874 9:20276635-20276657 GTGTGGAAGGGAAATGTGAAGGG - Intergenic
1052442182 9:28511661-28511683 TTGGGGAAGAGGTATGTGAATGG - Intronic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052652780 9:31325324-31325346 TTGTGGAATGGGTTGGGGAATGG + Intergenic
1053006345 9:34607430-34607452 CTGGGGGAGGGGTAGGTGATGGG - Intergenic
1053605949 9:39658657-39658679 CTGGGGAAGGGATAAGTGAAGGG - Intergenic
1053863867 9:42415281-42415303 CTGGGGAAGGGATAAGTGAAGGG - Intergenic
1054247596 9:62683759-62683781 CTGGGGAAGGGATAAGTGAAGGG + Intergenic
1054561712 9:66718286-66718308 CTGGGGAAGGGATAAGTGAAGGG + Intergenic
1055953336 9:81751152-81751174 CTGTGGGAGGCGGAGGTGGACGG - Intergenic
1056365537 9:85900760-85900782 TTGGGGAAGAAGTAGGTGAATGG - Intergenic
1056681467 9:88722809-88722831 CTGGTGAGGGGGGAGGTGAAAGG - Intergenic
1056935766 9:90913921-90913943 CTGGGGAATGGGCAGGTGAAAGG + Intergenic
1058112394 9:101045377-101045399 TTGTGGAATGGGTGAGTGAATGG + Intronic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1059471961 9:114511862-114511884 CAGAGGAAGAGGTAGGGGAAAGG + Intergenic
1059626563 9:116073384-116073406 CTGTGGATGGGGAAGCAGAAAGG + Intergenic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061959378 9:133980207-133980229 CGGTGGAGGGGGGAAGTGAATGG + Intronic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062145997 9:134989964-134989986 CTGGGGGAGAGGTGGGTGAAAGG + Intergenic
1185566605 X:1099730-1099752 CAGGAGAAGGAGTAGGTGAAGGG + Intergenic
1186343123 X:8664040-8664062 CTGTCAAAGGGGTGGGGGAAGGG + Intronic
1186785174 X:12950430-12950452 CTTTGGAAGCGGTCAGTGAATGG - Intergenic
1187092194 X:16108337-16108359 CAGTGGAATGAGTGGGTGAAAGG + Intergenic
1187500347 X:19833606-19833628 CTGTGGAAAGGCGAGGTGGATGG - Intronic
1189483281 X:41409219-41409241 CTGCAGAAGGCTTAGGTGAAAGG + Intergenic
1189498264 X:41529334-41529356 CTGTGCAAGGGCAAGGAGAAAGG + Intronic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1192269646 X:69566673-69566695 CTGGAGAAGGGGCAGGTGTAGGG + Intergenic
1192661486 X:73047153-73047175 TTGGGGAAGAGGTATGTGAATGG - Intergenic
1192844496 X:74891874-74891896 CTGTGAAAGGGTGAGGGGAAAGG - Intronic
1193054923 X:77139718-77139740 CTGTGGCATGGGGAGGAGAATGG - Intergenic
1194849163 X:98851540-98851562 TTGAGGAAGAGGTATGTGAATGG - Intergenic
1195065034 X:101232750-101232772 CCGGGGAAGGGGTAGGTTAATGG - Intronic
1195756873 X:108207325-108207347 CGGTGGGTGGGGTAGGGGAAGGG + Intronic