ID: 909153056

View in Genome Browser
Species Human (GRCh38)
Location 1:72033662-72033684
Sequence CAATGTATGAGACATCTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909153055_909153056 -6 Left 909153055 1:72033645-72033667 CCAAACTTTAGTGACATCAATGT 0: 1
1: 0
2: 0
3: 16
4: 132
Right 909153056 1:72033662-72033684 CAATGTATGAGACATCTAACTGG 0: 1
1: 0
2: 1
3: 4
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909153056 Original CRISPR CAATGTATGAGACATCTAAC TGG Intronic
903432667 1:23319306-23319328 CAATGTCTAAGACATCAAAGAGG - Intronic
907802184 1:57780205-57780227 AAATGTATGAGAAATATAACTGG - Intronic
909153056 1:72033662-72033684 CAATGTATGAGACATCTAACTGG + Intronic
910222869 1:84906253-84906275 CAATGTATGAGACTCCTAGTTGG - Intergenic
910572891 1:88725368-88725390 CAATGTATGAGAGATCCAGTTGG + Intronic
910828782 1:91438778-91438800 CAGTCTAATAGACATCTAACTGG - Intergenic
912575097 1:110663122-110663144 CAAGGTATTAGACATTTAAGAGG - Intergenic
919418308 1:197339472-197339494 CAATGTATGTGATGCCTAACAGG - Intronic
924849672 1:247813854-247813876 CAATGTATGAGATAACTAGAAGG + Intergenic
1064286061 10:13992342-13992364 CTATATTTGACACATCTAACCGG + Intronic
1068492450 10:57741154-57741176 AAATGTATGAGACATCTAGAAGG - Intergenic
1068688967 10:59896450-59896472 CCATATATGGGACAGCTAACAGG + Intronic
1069088838 10:64175012-64175034 CAAAGTGTGAGGCATCTGACAGG + Intergenic
1075299035 10:121304164-121304186 TAATTTATGAGAATTCTAACAGG - Intergenic
1078888948 11:15536337-15536359 CAATGTAGGAAACAACTACCAGG + Intergenic
1081018434 11:37911865-37911887 AAATGTATGAGAAAGCTAATAGG + Intergenic
1085591205 11:77762879-77762901 CACTGTAAGAGCCATGTAACAGG + Intronic
1087872569 11:103315196-103315218 ACATGTTTGAGACATCCAACTGG - Intronic
1088389884 11:109302515-109302537 AAATCTATGAGGCATCTACCTGG + Intergenic
1095673131 12:44884317-44884339 AAATGTATGAAACATTTACCTGG + Intronic
1096715354 12:53487769-53487791 CAATGAATTAGTCATCTTACAGG - Intronic
1104105074 12:125651343-125651365 CAAGGTATGATACAACTAAAAGG - Intronic
1106511189 13:30414155-30414177 AAATGTATTATACATATAACTGG + Intergenic
1109608950 13:64738290-64738312 AGATGTAAGAGACCTCTAACTGG - Intergenic
1112070327 13:95843240-95843262 CAATGTATGCGAATTCTAGCAGG + Intronic
1115912408 14:38270981-38271003 CACTGTATGATTCATATAACTGG + Intergenic
1117165825 14:53032138-53032160 CAATGTAGTAGACATAAAACTGG - Intergenic
1127149245 15:56056545-56056567 TATTGAATGAGAGATCTAACTGG - Intergenic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1131687628 15:94787609-94787631 TGATGCATCAGACATCTAACTGG - Intergenic
1135848155 16:25937978-25938000 CAGGGTTGGAGACATCTAACTGG + Intronic
1137282990 16:46993685-46993707 CAATGTATGAGAGTTCTAGTTGG - Intergenic
1138767228 16:59618744-59618766 CAATATAAGAGACACTTAACTGG - Intergenic
1143984018 17:10895602-10895624 CAATGAAAGAGAAATCTAAGTGG - Intergenic
1144112978 17:12056485-12056507 CAAAGGATGAGAAATCTAGCTGG - Intronic
1146610354 17:34299433-34299455 CAATTTAGGAGACATGGAACTGG + Intergenic
1150145889 17:62769016-62769038 CATTCTATGAGACAGCTGACTGG - Intronic
1150580030 17:66464490-66464512 CAATGAATGAGAGATCTCATTGG + Intronic
1151064642 17:71135721-71135743 CGATGTAGGAAAAATCTAACAGG - Intergenic
1154257471 18:12795997-12796019 CAATGTAGGAGACATTGAAGAGG - Intronic
1155444149 18:25893212-25893234 TAATGTGTGAGACCTCTAGCTGG - Intergenic
1156871833 18:41954436-41954458 CAATGCATTAGACAGCTAGCGGG + Intergenic
1157030439 18:43900386-43900408 CAATGTAGGAGATGTCTAAGGGG + Intergenic
1157184550 18:45527379-45527401 TAATAAATGAGACATCTAAAGGG - Intronic
1157329654 18:46694332-46694354 CAATATATGAGACATATTAAGGG - Intronic
1157944043 18:51958838-51958860 CGATGTTTGAGTCATCTAAAAGG - Intergenic
1164953176 19:32356201-32356223 AAATGTGTAAGAGATCTAACTGG - Intronic
926669928 2:15567344-15567366 AAATGTATGACACCTATAACAGG - Intergenic
927392760 2:22613464-22613486 CAAAGTTTGAGACTTCTAAACGG + Intergenic
927578227 2:24218400-24218422 CAATTTGTGAGACATTCAACAGG + Intronic
930632615 2:53770223-53770245 AAATGTATGAGAAGACTAACAGG + Intronic
932508364 2:72259646-72259668 CAATGTATGAGAGCTCTAACTGG + Intronic
934145751 2:89092345-89092367 CAATGTATAAGACATTTCATAGG - Intergenic
937616345 2:123926797-123926819 CATAGTATGAGAAATGTAACTGG + Intergenic
937621207 2:123989611-123989633 CAATATATGAGAATTCTAGCTGG - Intergenic
938972806 2:136447884-136447906 CAAGGAGTGAGAAATCTAACCGG + Intergenic
939084719 2:137705973-137705995 CAATTTATGAGAGATTTATCAGG + Intergenic
940725827 2:157335107-157335129 CATTGTAATAGTCATCTAACTGG + Intergenic
940957941 2:159749669-159749691 CTATGAATGAAACATCTTACTGG - Intronic
942812350 2:180014086-180014108 CAATGTAAGACTCTTCTAACAGG - Intergenic
944862193 2:203825610-203825632 CAATGTATGTGGCATATAGCAGG + Intergenic
944901543 2:204221608-204221630 GAATCTAGGAGACATCCAACTGG - Intergenic
945525256 2:210880742-210880764 CAATGAATGAGAGAACTAAGGGG - Intergenic
945546438 2:211158560-211158582 CAATGACAGAGACATCTAACTGG + Intergenic
947286498 2:228522428-228522450 CAATGTATGACTCCTCTAATGGG - Intergenic
1170993706 20:21330537-21330559 CAAAGTATGAGACTACTTACTGG - Exonic
1176875240 21:14120525-14120547 CACTGTAAGGGACATCAAACAGG + Intronic
1178148282 21:29764963-29764985 TAATGTATAAAACATCTAAAAGG - Intronic
951488031 3:23235869-23235891 AAATGTCTGAGACATCCAAATGG + Intronic
954728208 3:52634582-52634604 TAATGTAGAAGACATCTTACCGG + Exonic
959214394 3:103432175-103432197 CACTTTATGAGACTTCTAAATGG - Intergenic
963383184 3:144557643-144557665 CAATATCTGAGTCATGTAACTGG + Intergenic
970526281 4:16935374-16935396 ATATGTATGAGAAATCTAAAAGG - Intergenic
974380921 4:61138723-61138745 CAATGTATGATTCATATAATTGG + Intergenic
975489721 4:74975181-74975203 GAATGTGTAATACATCTAACAGG - Intronic
979170573 4:117596777-117596799 AAATGTAAGAGGCCTCTAACTGG + Intergenic
981574361 4:146188763-146188785 CAAAGTATGAGACTTTTAACGGG + Intronic
983460504 4:168020838-168020860 CAATGTATGTGATGTATAACAGG + Intergenic
983816633 4:172137067-172137089 CTATGAATGAGAAATCTAAATGG - Intronic
988115103 5:26876815-26876837 CAAGGTATGAGACAACAATCTGG + Intergenic
988233748 5:28511535-28511557 CAATGTTTCAAACATTTAACTGG + Intergenic
995819605 5:116214770-116214792 CAATGTAGCAGACATTTAAATGG - Intronic
997556497 5:134803744-134803766 CAATGTAGGAGAAACCTTACTGG - Intronic
999398963 5:151249800-151249822 TAAGGTCAGAGACATCTAACAGG - Intronic
1001706545 5:173745114-173745136 TATTGCATGAGACATTTAACTGG + Intergenic
1003846635 6:10181033-10181055 AAATGTATGAGACTTTTATCAGG - Intronic
1004488954 6:16095547-16095569 CAATTTAAGAGACACCTAAGCGG - Intergenic
1005876239 6:30011831-30011853 CAATGGAGGAGACATCTATGAGG + Intergenic
1006152300 6:31996020-31996042 AACTGCAGGAGACATCTAACTGG + Exonic
1006158603 6:32028758-32028780 AACTGCAGGAGACATCTAACTGG + Exonic
1009670416 6:66741407-66741429 CAAAATATGAGACATCGAGCAGG - Intergenic
1010698966 6:79017719-79017741 AAATATATAACACATCTAACTGG + Intronic
1010942679 6:81937344-81937366 CAATGAATGAATCATCCAACAGG + Intergenic
1012452299 6:99365248-99365270 CAATGGATGATACAACTAATGGG + Intergenic
1013464539 6:110406252-110406274 AAATGCATGAGACTTCTAAGTGG - Intronic
1014198655 6:118585381-118585403 CATTGTAGGAGACATCAAAAGGG + Intronic
1016854324 6:148651356-148651378 AGATGTAAGAGACGTCTAACTGG - Intergenic
1018224795 6:161617999-161618021 CAGTGTATGGGACACCAAACGGG + Intronic
1020415596 7:7942177-7942199 CAATATATGAGAGCTCTAATAGG - Intronic
1021819747 7:24485048-24485070 TTTTGTATGAGACATCTAAATGG - Intergenic
1023072037 7:36444944-36444966 AAATGTTTGAGACATCCAAAAGG + Intronic
1023743572 7:43302257-43302279 CCATGGATGAGGCAGCTAACTGG + Intronic
1025833257 7:65073054-65073076 CAAAGTAGGAGACAGATAACAGG + Intergenic
1025903019 7:65762560-65762582 CAAAGTAGGAGACAGATAACAGG + Intergenic
1026249730 7:68659104-68659126 CAATGTCTGACACATGTACCAGG - Intergenic
1028893205 7:96011796-96011818 CAATGTATCATATATATAACTGG - Intronic
1029282656 7:99446484-99446506 GGATGTGTGAGACTTCTAACGGG - Intronic
1031729737 7:125284427-125284449 AAATGTTTGAAACATCTTACTGG - Intergenic
1033712641 7:143964545-143964567 GACTGTATGAGAAATCCAACAGG - Intergenic
1036996848 8:13667820-13667842 CAATGCCTCAGACGTCTAACTGG - Intergenic
1039422073 8:37451519-37451541 CTATGGATGAGACATGGAACTGG + Intergenic
1039725846 8:40215707-40215729 GAATGTAAGAGGCATTTAACTGG + Intergenic
1045711917 8:104994853-104994875 CAATGTATGAAAAATCTCTCTGG - Intronic
1046430006 8:114112754-114112776 CATTGTATAACTCATCTAACAGG - Intergenic
1046802893 8:118448621-118448643 CAATATAGGAGAAATCTAATCGG - Intronic
1047859635 8:128951211-128951233 CAATGGATGAGACCTCTTCCAGG + Intergenic
1048002669 8:130392337-130392359 CTTTGAATAAGACATCTAACAGG + Intronic
1049823126 8:144648226-144648248 CTATGGATGAGCCATCTTACTGG - Intergenic
1050137348 9:2480332-2480354 TAATCTTTGAGACATCTAAGTGG - Intergenic
1056421645 9:86433784-86433806 CATTATTTGAAACATCTAACAGG + Intergenic
1060242528 9:121916852-121916874 CCAAGTAAGAGACATCTACCTGG - Intronic
1192460968 X:71317097-71317119 GAATGTATGAGACAAATAAAAGG - Intergenic
1192461643 X:71322108-71322130 GAATGTATGAGACAAATAAAAGG + Intergenic
1194808564 X:98361776-98361798 CAGTGTATAAGCCATCTAATAGG - Intergenic
1195640733 X:107171955-107171977 CAATGTATGAGACTTGTGAAGGG - Intronic