ID: 909153162 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:72034913-72034935 |
| Sequence | TGGCTTCCAGGTACAGCTGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 909153162_909153165 | -7 | Left | 909153162 | 1:72034913-72034935 | CCAGCAGCTGTACCTGGAAGCCA | No data | ||
| Right | 909153165 | 1:72034929-72034951 | GAAGCCAGGTACATTCAATATGG | 0: 12 1: 14 2: 31 3: 67 4: 194 |
||||
| 909153162_909153167 | 29 | Left | 909153162 | 1:72034913-72034935 | CCAGCAGCTGTACCTGGAAGCCA | No data | ||
| Right | 909153167 | 1:72034965-72034987 | CTTCCTTGTCACCACGTTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 909153162 | Original CRISPR | TGGCTTCCAGGTACAGCTGC TGG (reversed) | Intronic | ||