ID: 909153162

View in Genome Browser
Species Human (GRCh38)
Location 1:72034913-72034935
Sequence TGGCTTCCAGGTACAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 5, 1: 6, 2: 5, 3: 26, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909153162_909153165 -7 Left 909153162 1:72034913-72034935 CCAGCAGCTGTACCTGGAAGCCA 0: 5
1: 6
2: 5
3: 26
4: 204
Right 909153165 1:72034929-72034951 GAAGCCAGGTACATTCAATATGG 0: 12
1: 14
2: 31
3: 67
4: 194
909153162_909153167 29 Left 909153162 1:72034913-72034935 CCAGCAGCTGTACCTGGAAGCCA 0: 5
1: 6
2: 5
3: 26
4: 204
Right 909153167 1:72034965-72034987 CTTCCTTGTCACCACGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909153162 Original CRISPR TGGCTTCCAGGTACAGCTGC TGG (reversed) Intronic
900161463 1:1226111-1226133 TGGCTTCCAGCTCCAGCCACGGG + Intronic
901013153 1:6212136-6212158 TGGCTCCCAGCTTCAGCAGCTGG - Intronic
901784399 1:11615202-11615224 TGGATTCCATGCACAGCTGCTGG - Intergenic
902245623 1:15118662-15118684 AAGCTTCCAGGTGCTGCTGCCGG + Intergenic
902295313 1:15463081-15463103 TTGCTGCCAGTTACACCTGCAGG + Intronic
902611044 1:17597353-17597375 TGGCTTCCATGGACAGCGGCTGG + Intronic
902683723 1:18061912-18061934 TGGCTTCCAGACACACCTGTAGG - Intergenic
902843087 1:19087803-19087825 CAAGTTCCAGGTACAGCTGCTGG - Exonic
903189886 1:21650621-21650643 GGGCTCCCAGGGACAGCTGATGG + Intronic
903629246 1:24754342-24754364 TGGCTTCTAGGCACCTCTGCAGG - Intronic
903741241 1:25559908-25559930 TGGGTTCCAGGTACTGATGCTGG - Intronic
904430840 1:30463042-30463064 TGGCTTCTTGGGTCAGCTGCTGG + Intergenic
906294250 1:44639501-44639523 GGGCTTAAAGATACAGCTGCAGG - Intronic
909153162 1:72034913-72034935 TGGCTTCCAGGTACAGCTGCTGG - Intronic
912724467 1:112046355-112046377 TGGCTTCCAGCTATGGCTGAGGG - Intergenic
913004919 1:114620099-114620121 TCCCTTCCAGGGACAGCTGGAGG + Intronic
913207626 1:116555721-116555743 TGGGTTCCAGTTACAACTTCAGG - Intronic
913356705 1:117929940-117929962 GGGCTTCCAAGTACTGCTGTGGG - Intronic
913570011 1:120110405-120110427 TGGATTCCATGGACTGCTGCAGG + Intergenic
913613358 1:120530372-120530394 TTGTTTCCAGGTGCAGCTGCAGG - Intergenic
914290819 1:146271371-146271393 TGGATTCCATGGACTGCTGCAGG + Intergenic
914371712 1:147031128-147031150 TTGTTTCCAGGTGCACCTGCAGG - Intergenic
914551863 1:148722154-148722176 TGGATTCCATGGACTGCTGCAGG + Intergenic
914577828 1:148991875-148991897 TTGTTTCCAGGTGCAGCTGCAGG + Exonic
915010805 1:152684661-152684683 TGGCTTCCAGGTACTTTAGCAGG - Intergenic
915252200 1:154598526-154598548 TTGCTTCCAGCTTCAGCTGGGGG + Exonic
915445787 1:155974268-155974290 CTGCTGCCAGGTACAGCTGGAGG - Intronic
917085301 1:171298916-171298938 TTGCTTCCAGGTACAGCTGCTGG + Intergenic
919287410 1:195581565-195581587 TTCTTTCCAGGTAGAGCTGCTGG + Intergenic
920693757 1:208165945-208165967 TGACTTCCTGCTACAGCTGAGGG + Intronic
922887397 1:229030790-229030812 TGGCTTCCAGGTACAGCTGCTGG - Intergenic
1062897392 10:1114705-1114727 TGACTTCCAGCTGCAGCTCCTGG - Intronic
1063288740 10:4718129-4718151 TGGCTGCCAGTAACTGCTGCAGG - Intergenic
1063812038 10:9722334-9722356 TGGCTTCCAGCTGTAGGTGCTGG + Intergenic
1066115055 10:32232533-32232555 TGGATTCCAGGTACAGCTGCTGG - Intergenic
1069180156 10:65348941-65348963 TGGCTTCCAGGTACAGCTGCCGG + Intergenic
1071463001 10:85916201-85916223 TGGCTTCCAAGGACAGCCACTGG - Exonic
1073217144 10:101842735-101842757 TGGCTTCCTGGTACAGATAGGGG - Intronic
1074840546 10:117346660-117346682 TGGCTTCCAGGTACAGCTGCTGG - Intronic
1076866462 10:133168761-133168783 AGGCCTCCAGGCACAGCTCCTGG + Intronic
1076978787 11:194408-194430 TGCCTTCCAGGTGCAAGTGCTGG + Exonic
1080438728 11:32270699-32270721 TGGCTTCAAGGTACAGGTTTTGG - Intergenic
1081776219 11:45677674-45677696 TGGCCCCCAGGGAGAGCTGCAGG + Intergenic
1082792646 11:57357563-57357585 TGGCTCTCAGGTACATCTTCTGG + Intronic
1083332407 11:61905009-61905031 TGGCTTCCCTGCACGGCTGCTGG - Intronic
1083504189 11:63139818-63139840 TGGCTTCCAGGTAGAGCCCTTGG - Intronic
1083897634 11:65628074-65628096 GGGGTTCCAGGTACCACTGCTGG - Intronic
1084271740 11:68032818-68032840 TCACTTCCAGGTGCAACTGCTGG - Intronic
1084327721 11:68411426-68411448 TGCCTTCCAGCTACATCTACTGG + Exonic
1084459753 11:69289997-69290019 TTGCTTGCAGGTGCAGCTGTAGG + Intergenic
1084674837 11:70628310-70628332 TGGCTTCCACGTTCTGCTCCCGG - Intronic
1085217201 11:74843391-74843413 TGGCCTCCAGGTACTGCTTGTGG + Exonic
1087414938 11:97842112-97842134 TTGCTTGCAGCTACAGCCGCAGG - Intergenic
1090205677 11:124882803-124882825 TGGCCTCCAAGTAGAGCTGCTGG + Intergenic
1090940636 11:131385056-131385078 TGGCCTCCAGGAGCATCTGCAGG - Intronic
1091178522 11:133582315-133582337 GGGCTTCCAGACACAGCAGCTGG + Intergenic
1091665823 12:2417936-2417958 GGCCTCCCAGGTACAGGTGCTGG + Intronic
1092868706 12:12786959-12786981 GCGCTTCCAGGGACTGCTGCTGG + Exonic
1093071922 12:14714752-14714774 TGGCTTCCAGGTACAGCTGCCGG + Intergenic
1093888354 12:24489454-24489476 TTTCTTCCAGGCACAGCTGTGGG - Intergenic
1096260822 12:50089916-50089938 TGGCTTTCAGGTGAAGCGGCCGG + Exonic
1096438326 12:51615515-51615537 TGTCTTCCAGCTACGGCAGCAGG + Intronic
1096472601 12:51888830-51888852 TGGCTTCCCAGAACAGCTGGGGG + Intronic
1096578572 12:52569960-52569982 TGGCTGCCAGCTGCAGCTCCTGG + Exonic
1101875826 12:108596556-108596578 TGGCTTCCAGGGAAAGGTGGGGG + Intronic
1103523022 12:121548971-121548993 TGGCTTTCAGGTAGACCTGGTGG - Exonic
1103904968 12:124322456-124322478 TGGCCCCCAGGTATAGCTACAGG - Intergenic
1103911318 12:124354184-124354206 TGTCTTCCAGGGACAGCTCTGGG - Exonic
1104757352 12:131277458-131277480 TAACTTCCAGCTTCAGCTGCAGG + Intergenic
1104775694 12:131389016-131389038 TAACTTCCAGCTTCAGCTGCAGG - Intergenic
1107147026 13:37070269-37070291 TGGGCTCCATGGACAGCTGCAGG + Intergenic
1112384868 13:98930334-98930356 TGGCTGCCAGGGCCAGCTGCAGG - Intronic
1115483597 14:33886704-33886726 TGGCTTCCAGTGACAGGTTCCGG - Intergenic
1120941970 14:89957534-89957556 TGGCCTCCAGGCCCAGCTGATGG + Intronic
1121330885 14:93049208-93049230 TGGCTTCTAGGTAGACCTGGGGG + Intronic
1122886544 14:104712920-104712942 TGTCCTCCAGGGACAGCTGCTGG - Exonic
1123715357 15:23025488-23025510 TGGCTTCCAGGTACGGGCACAGG + Intronic
1124594769 15:31083423-31083445 TGGTGTCCTGGCACAGCTGCAGG + Intronic
1125603997 15:40929864-40929886 CGTCTTCCAGCTGCAGCTGCAGG + Exonic
1126844375 15:52745421-52745443 TGGCTTCCAGATACACCTGCTGG - Intergenic
1127642178 15:60926279-60926301 TGCCTTCCAGGTTCTGCTGCAGG - Intronic
1128394269 15:67208067-67208089 TGGATTCCAGCTTCAGCTCCAGG + Intronic
1131538777 15:93258729-93258751 GGGCTCCCAGGTGCTGCTGCTGG + Intergenic
1131553912 15:93380419-93380441 TGGGTTCCAGGTACTGCTCTGGG - Intergenic
1131989145 15:98076663-98076685 AGGCTTCCAGGAACAGCAGAGGG + Intergenic
1132156926 15:99502331-99502353 TGGCAGCCAGGCACAGCTCCTGG - Intergenic
1132405746 15:101541100-101541122 AGGGTTCCAGGAACAGCTACAGG + Intergenic
1132432330 15:101772096-101772118 TCCCTTCCAGGTGAAGCTGCTGG - Intergenic
1132500266 16:281849-281871 TGTCGTCCGGGTCCAGCTGCCGG - Exonic
1132670719 16:1101262-1101284 TGGCAGCCAGGCGCAGCTGCAGG + Intergenic
1132841749 16:1981400-1981422 GGACTTCCAGGCAGAGCTGCTGG + Exonic
1132851103 16:2025455-2025477 TGGCTTTTAGGGGCAGCTGCCGG + Intronic
1135062315 16:19281309-19281331 TGGATTCCAGGTTCAGCTTTAGG - Intergenic
1136556886 16:31012149-31012171 TGGCTCGCAGGTACAGATGTGGG - Intergenic
1137540170 16:49356459-49356481 TGCATTCCAGGCAGAGCTGCAGG - Intergenic
1139551477 16:67675394-67675416 TGCCCTTCAGGTACAGCAGCGGG + Exonic
1140349424 16:74247913-74247935 AGGATTCCAGGCACAGCTGAGGG - Intergenic
1140649020 16:77066441-77066463 TGGCTTCCAGCTCCAGGTGATGG - Intergenic
1140997707 16:80277445-80277467 TGGCTTCACAGTACAGCAGCTGG + Intergenic
1141066949 16:80921671-80921693 AGGTTTCCAGGTAAGGCTGCAGG + Intergenic
1141419012 16:83899597-83899619 GCGCTTCCTGGTGCAGCTGCGGG + Exonic
1142262715 16:89050328-89050350 GGGCTTCCAGCAACAGGTGCAGG - Intergenic
1142466217 17:138900-138922 TGCCTTCCAGGTGCAAGTGCTGG + Exonic
1146885242 17:36465849-36465871 CGGCTCCCAGCTAGAGCTGCAGG + Intergenic
1147363188 17:39944149-39944171 TGGCATCCAGGTAGAGCTTGCGG - Exonic
1148335183 17:46836061-46836083 GGGCTCCCAGGAACAGCAGCTGG + Intronic
1149469203 17:56902283-56902305 GGTCTTTCAGGTATAGCTGCAGG + Intronic
1150336919 17:64337121-64337143 TGGGTTGGAGGCACAGCTGCAGG + Intronic
1150392836 17:64800045-64800067 TGGCCACCAGGTACTGCAGCAGG + Intergenic
1153046097 18:856942-856964 TGTCTTCCAGCTTCTGCTGCTGG - Intergenic
1159117898 18:64136232-64136254 TGCCTTCCAAGTACAGATGAGGG + Intergenic
1159978145 18:74741013-74741035 TGCCTTCCAGCTACTGCTACTGG - Intronic
1160142856 18:76340745-76340767 TGTCTCCCAAGCACAGCTGCAGG + Intergenic
1161066988 19:2243508-2243530 TGGTCTCCAGGGCCAGCTGCCGG - Exonic
1161295536 19:3518345-3518367 TAGCTGCCAGGTACAGCAGGAGG - Intronic
1161865250 19:6828460-6828482 TGGCATCCAGGGCCAGCCGCAGG - Exonic
1162409914 19:10499496-10499518 TGACTTCCTGGTGCAGCAGCTGG - Exonic
1165271548 19:34711949-34711971 TGGCTTCCAGGTACCGCTGCTGG - Intergenic
1165275103 19:34743635-34743657 TGGCTTTGAGGTAGTGCTGCTGG + Exonic
1165493875 19:36140904-36140926 TTCCTCCCAGGTCCAGCTGCCGG + Intronic
1167509795 19:49889996-49890018 TGGCTTTGTGGTACAGCCGCCGG - Exonic
1167863884 19:52308206-52308228 TGACTTCCACGTGCAGCTTCTGG - Intronic
924980993 2:221580-221602 TGGTTTTCAGGTGCAGCTGAAGG + Intronic
925143474 2:1565576-1565598 TGGCTTACTGGTATAGCGGCTGG - Intergenic
926806513 2:16716637-16716659 TGCCTTCCAGGTACAGCTCCGGG + Intergenic
929437258 2:41938324-41938346 TGGTTTCCAGACCCAGCTGCAGG - Exonic
932583791 2:73009556-73009578 TGGCTGCCTCGTAGAGCTGCTGG + Intronic
932715652 2:74099485-74099507 TGGCTTCCAGCTGCCGCTGGCGG - Exonic
933285967 2:80385068-80385090 TGCATTCCAGGTACAACTCCAGG + Intronic
934307731 2:91840690-91840712 TGGCTTCCAGGTCCTGCTCCGGG - Intergenic
934503827 2:94877254-94877276 TGGCTGCTAGGTGCACCTGCTGG + Intergenic
936061994 2:109300944-109300966 TGGCTACCAGCTGCAGATGCTGG + Intronic
937672552 2:124553839-124553861 TGGCTCCCAGGGTCAGCTCCCGG + Intronic
940200639 2:151146380-151146402 TGTCATCCAGTCACAGCTGCTGG + Intergenic
944816806 2:203385635-203385657 TAGCTTTCAGGTACAGTTGAAGG + Intronic
945428953 2:209741760-209741782 TGGCTTTCAGAAACAGCTGTTGG - Intergenic
946972712 2:225112877-225112899 TGCATTCCAGGTTCGGCTGCAGG + Intergenic
948220772 2:236267987-236268009 TCGCCTCCAGATCCAGCTGCTGG + Intergenic
1170159853 20:13299722-13299744 TGGCTTCCAGGTTCTTCTTCTGG - Exonic
1173824850 20:46041561-46041583 TGGCATCCAGGGAACGCTGCAGG + Intronic
1174113169 20:48210249-48210271 GGACTTCCAGCCACAGCTGCAGG - Intergenic
1175208482 20:57329989-57330011 TGGCCTCCAGGTACAGGAGCTGG + Exonic
1175855385 20:62118307-62118329 CCGCTTCCAGGTGCAGCTGGAGG - Intergenic
1175870237 20:62205895-62205917 TGGCTTCCTGGCACAGCCACAGG - Intergenic
1179469508 21:41601230-41601252 AGGCTCCCAGGGACACCTGCGGG - Intergenic
1179478871 21:41665403-41665425 TGGCTTCCAGGAGCCCCTGCAGG + Intergenic
1179902037 21:44399384-44399406 TGGCCTCCAGGGCGAGCTGCAGG - Exonic
1180955153 22:19738162-19738184 TGGCTTCCGGGTCCGGCTGTGGG + Intergenic
1182302008 22:29342198-29342220 TGGCTTCCAGGTCTAGTTCCTGG + Intronic
1182556919 22:31134249-31134271 AGGCTTCGAGGCACAGCTGGTGG - Exonic
1183070676 22:35393856-35393878 TGTCTTCCAGGCTCTGCTGCAGG - Exonic
1184176367 22:42791831-42791853 TGGCTGCCAGGAACACCAGCTGG - Intergenic
1184709273 22:46238871-46238893 ATGCTTCCAGTTACAGCGGCAGG + Exonic
1185005998 22:48277316-48277338 TGGAGTCCAGGTGCACCTGCAGG - Intergenic
949192555 3:1267494-1267516 GGGCTTCCTGGTACAGGAGCCGG - Intronic
950042749 3:9930663-9930685 TGGGTTCCAGGGAGAGCTTCCGG + Intronic
950092481 3:10305643-10305665 AGGCTTCCAGGTACAACAGCAGG + Exonic
950283405 3:11725777-11725799 TGGCTTCCAGGGAGATCAGCCGG - Intergenic
950417814 3:12878336-12878358 TGGCTTGCAGGGCCAGCTTCTGG + Intergenic
950502402 3:13372791-13372813 TGGCTTCCGGGGCCAGCTGGCGG - Intronic
952409480 3:33034340-33034362 AGGCTTCCAGGTACAACAGCAGG - Intronic
952848889 3:37711817-37711839 TGGGTGCCAGGTACTGCTGCAGG - Intronic
953760736 3:45684820-45684842 TGTCTTCCAGGTGCAGCTGCCGG + Exonic
954205792 3:49057878-49057900 TTGCTTACAGGTCCAGGTGCAGG - Exonic
954453952 3:50586850-50586872 TGACTTCCAGGAACAGCAGAGGG - Intergenic
959849402 3:111070642-111070664 TGGCTCCAAGGTCAAGCTGCCGG + Intronic
960564708 3:119120793-119120815 TGGCTTCCAGGTACAGCTGATGG + Intronic
961565855 3:127762929-127762951 TGGGTTCCAGTCCCAGCTGCAGG - Intronic
963160926 3:142149769-142149791 CCGCCTCCAGGGACAGCTGCGGG + Intergenic
963628277 3:147701290-147701312 AGTCTTCCAGCTACAGCTGCAGG + Intergenic
965456419 3:168906496-168906518 TGGCTGCCATGGACACCTGCTGG - Intergenic
968487527 4:871078-871100 TGGGTTCCTGGGACAGCTGCTGG - Intronic
968503027 4:959961-959983 TGGATCTCAGGTACAGCTCCAGG - Exonic
968931588 4:3582208-3582230 TGTCTGCCAGGCACAGCTGCAGG + Intronic
969263362 4:6047456-6047478 TGGCTATCAGGTGCAGGTGCAGG - Intronic
969289362 4:6228809-6228831 TGGCTGGAAGGTACAGCTGGGGG - Intergenic
969494234 4:7516731-7516753 TCCCTTCCTGGTTCAGCTGCAGG - Intronic
970315067 4:14821324-14821346 TGGATTTCAGGTACAACAGCTGG - Intergenic
972168227 4:36312970-36312992 TGGCTTAGAGGTAGAGCTGGTGG + Intronic
973019569 4:45185743-45185765 GGCCTTCCAGGGTCAGCTGCAGG + Intergenic
973194754 4:47426900-47426922 TGGCTTCCTGGCACAGCATCAGG - Intergenic
973840452 4:54855456-54855478 AGGCTTCCGGGTGCAGCTGTGGG + Intergenic
975170900 4:71230936-71230958 TGGCTTCACGGTAAAGCAGCAGG + Intronic
975177246 4:71301829-71301851 TGTCTTCCATGTGCCGCTGCAGG + Intronic
975199466 4:71568949-71568971 TAGCATCTAGGTACAGATGCTGG + Exonic
978344515 4:107753214-107753236 TGGCAGCCTGGAACAGCTGCGGG - Intergenic
983022087 4:162689944-162689966 TGGTTTCCAGGGACTGCTGAGGG + Intergenic
984908867 4:184653227-184653249 TGGATTCCAGGAGCAGCTGAAGG - Intronic
985996542 5:3600251-3600273 ACGCTCCCAGGTACAGCTCCAGG + Exonic
990663318 5:58043274-58043296 AGGCCTCTAGGTACAACTGCAGG - Intergenic
994923049 5:106076918-106076940 TGACTTCCAGGCACAGCTTCTGG - Intergenic
996543341 5:124652209-124652231 TGGCTTCCAGAAAGAGCAGCAGG - Intronic
1000393372 5:160748102-160748124 AGGCTTCCAGAAACAGCTGCAGG + Intronic
1001452020 5:171834019-171834041 TGGCTTTCAAGTTCAGCTCCTGG + Intergenic
1001673396 5:173492703-173492725 GGCCTTCCAGGGACAGCTGTGGG - Intergenic
1001952848 5:175828371-175828393 TTGCTTCCACATACAGATGCTGG - Intronic
1002086986 5:176782068-176782090 CGGCTTCCAGCTACATTTGCAGG - Intergenic
1002778403 6:348226-348248 GGGCTTCCAGAGACAGCTCCAGG + Exonic
1003637610 6:7847412-7847434 AGGCCTCCAGATTCAGCTGCAGG + Intronic
1005992342 6:30911194-30911216 TGGCTTCCAGTTCCTGTTGCTGG + Exonic
1006732311 6:36245574-36245596 TGCCTTCCAGGCACTGCTGCAGG + Intronic
1007201162 6:40110430-40110452 TGGCTTCCATGGAGACCTGCTGG - Intergenic
1007499033 6:42281235-42281257 TGTCTTCTTGGTTCAGCTGCAGG - Intronic
1008822645 6:55651811-55651833 TTGCCTCCATGTACAGGTGCTGG + Intergenic
1012074220 6:94663465-94663487 TTGCTTCCGGCTACAGTTGCTGG + Intergenic
1013067184 6:106695099-106695121 TGGCTTCCAGGGACACTTGTGGG + Intergenic
1014008660 6:116450987-116451009 TAGGTTCCAGGTGCAGCTGAAGG - Intergenic
1017522249 6:155212960-155212982 AAGCTTCCAGGTACTGATGCAGG - Intronic
1018848820 6:167573192-167573214 GGGCTTCCTGGTACCTCTGCGGG + Intergenic
1019386064 7:756925-756947 TGGCTGCCAGGTGCGGCTGGAGG - Exonic
1019428855 7:989293-989315 CTGCCTCCAGGCACAGCTGCAGG - Exonic
1024407547 7:48999834-48999856 CAGCTTCCAGGCACAGCTGCTGG - Intergenic
1027502355 7:78969046-78969068 TGGCTTCCAGGTGCAGCTGCTGG - Intronic
1028852937 7:95556916-95556938 TGCCTTCCTGATGCAGCTGCAGG - Intergenic
1030496440 7:110306640-110306662 TGGCTTCCAGATTCAGCAGGTGG - Intergenic
1033346298 7:140527676-140527698 AGGCTTGCAGGCACAGCTACAGG + Intronic
1035469315 7:159099672-159099694 TGTCTCCCAGGCACAGTTGCCGG + Intronic
1036386637 8:8287469-8287491 TGGGCTCCAGGAACAGCTGCAGG + Intergenic
1046014131 8:108585815-108585837 TGACCTTCAGTTACAGCTGCTGG + Intergenic
1046193467 8:110830101-110830123 TGGTTTCCAGGTAGCGCTGCTGG + Intergenic
1046194080 8:110835768-110835790 TGGCTTCTAGGTAGAGCTGCTGG + Intergenic
1048556668 8:135484423-135484445 TGGCTGCCAGGCACAGCCGGCGG - Intronic
1049348133 8:142149654-142149676 TGGCTTCCAGTTAGAGGGGCTGG + Intergenic
1049622955 8:143606792-143606814 TGCCTCCCAGGTACAGCACCAGG + Intronic
1049910811 9:265737-265759 TGGTTTCCTAGCACAGCTGCTGG + Intronic
1050221875 9:3400378-3400400 TGGTTTATAGGTACAGCTGGAGG - Intronic
1052273752 9:26655349-26655371 TGACTGACAGGTACAGCTGTAGG - Intergenic
1054458539 9:65449719-65449741 TGTCTACCAGGCACAGCTGCAGG - Intergenic
1055907355 9:81309958-81309980 TGGCTAGAAGGTACAGATGCTGG - Intergenic
1057803063 9:98201652-98201674 TGGCTTCCAGGTGGACCAGCGGG - Exonic
1057886615 9:98834530-98834552 TGGCTTCCAGATAAACCTGGTGG + Intronic
1059123236 9:111661399-111661421 TCGGTTCCAGGCCCAGCTGCAGG + Exonic
1059982901 9:119792747-119792769 TGGGTTCCAGTTACAGCTCTGGG - Intergenic
1060132026 9:121111167-121111189 TGCCTTCGATGTACTGCTGCAGG - Intronic
1060268503 9:122125997-122126019 TGTCCTGCAGGTACAGCAGCAGG - Intergenic
1061754028 9:132800188-132800210 GGGCTTGCAGGCCCAGCTGCCGG - Intronic
1062178629 9:135178692-135178714 TGGCCTGCAGGAACAGCTGCTGG + Intergenic
1062261360 9:135664787-135664809 TGGCTTCCACTTACAGTTGATGG - Exonic
1062464510 9:136675233-136675255 TGACTTCCAGGAACACCAGCAGG - Intronic
1187292482 X:17968648-17968670 TGGCTCCGTGGTTCAGCTGCTGG - Intergenic
1187392328 X:18894311-18894333 TGGCTTCCACCAGCAGCTGCCGG + Exonic
1189859771 X:45260617-45260639 TGGTTTGCGGGTACATCTGCCGG - Intergenic
1196873974 X:120140403-120140425 TGGCTTCCAGGTACAGCTGATGG - Intergenic
1197297509 X:124737106-124737128 TGGCTTCCTGGCACAGGTGCAGG + Exonic
1198274313 X:135087115-135087137 TGGCTTGGAGGTTCAGCTTCTGG - Intergenic
1201360967 Y:13148440-13148462 TGGCTTCCAGGTACAACTCCTGG - Intergenic