ID: 909153164

View in Genome Browser
Species Human (GRCh38)
Location 1:72034925-72034947
Sequence ATTGAATGTACCTGGCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 12, 1: 14, 2: 23, 3: 64, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909153164_909153169 25 Left 909153164 1:72034925-72034947 CCTGGAAGCCAGGTACATTCAAT 0: 12
1: 14
2: 23
3: 64
4: 161
Right 909153169 1:72034973-72034995 TCACCACGTTTATGGTGTCATGG No data
909153164_909153167 17 Left 909153164 1:72034925-72034947 CCTGGAAGCCAGGTACATTCAAT 0: 12
1: 14
2: 23
3: 64
4: 161
Right 909153167 1:72034965-72034987 CTTCCTTGTCACCACGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909153164 Original CRISPR ATTGAATGTACCTGGCTTCC AGG (reversed) Intronic
901150157 1:7095928-7095950 TTTGTGTGTTCCTGGCTTCCAGG - Intronic
901285610 1:8076337-8076359 GTTGAACATACCTGGCTTCCAGG - Intergenic
904327133 1:29734048-29734070 TTTGAATGTCCCAGGCATCCTGG - Intergenic
904630276 1:31836350-31836372 ATTCAAGGTACCTGCCTACCTGG - Intergenic
906743973 1:48208613-48208635 GTTGAACATACCTGGCTTCCAGG + Intergenic
909153164 1:72034925-72034947 ATTGAATGTACCTGGCTTCCAGG - Intronic
909489339 1:76208818-76208840 ATTGGATTTACCTGGATTCTAGG + Intronic
909535505 1:76731304-76731326 ATGGTAAGTACCTGGCTTTCTGG - Intergenic
909549677 1:76883822-76883844 ATTCATTGTTCCTTGCTTCCTGG - Intronic
909836474 1:80261050-80261072 ATTCAATGTACCTGACTGCCTGG + Intergenic
910070615 1:83208823-83208845 GTTGAACGTACCTGGCCCCCAGG + Intergenic
911011984 1:93289872-93289894 GTTGAACATACCTGGCTTCCAGG + Intergenic
911764621 1:101658604-101658626 ATTCAATGTTCCTATCTTCCTGG - Intergenic
911976418 1:104502479-104502501 ATTGAACATATCTGGCTTTCAGG + Intergenic
916266184 1:162891891-162891913 GTTAAACATACCTGGCTTCCAGG + Intergenic
917085299 1:171298904-171298926 ATTGAACATACCTTGCTTCCAGG + Intergenic
919319785 1:196021217-196021239 GTTGAATATACCTGGTTTCCAGG + Intergenic
921512474 1:216049315-216049337 ATTGAATTAACATGGCTTGCTGG + Intronic
921789221 1:219270625-219270647 GCTGAACATACCTGGCTTCCAGG + Intergenic
922157197 1:223049676-223049698 CTTCAATGCCCCTGGCTTCCAGG - Intergenic
922887398 1:229030802-229030824 TTGGAATGTACTTGGCTTCCAGG - Intergenic
923868213 1:237963029-237963051 GTTGAACATGCCTGGCTTCCAGG - Intergenic
924694759 1:246387524-246387546 TTTAAAAGTACCTGGCTTCCTGG + Intronic
1062783936 10:244589-244611 TTTGTCTGTACCTGGTTTCCTGG - Intronic
1063058584 10:2527646-2527668 GTTGAATATTCCTGCCTTCCTGG - Intergenic
1063795573 10:9510912-9510934 GTTGAATATACCTGGCTTCCAGG + Intergenic
1063938607 10:11105249-11105271 TTTGAATCTACCTCACTTCCTGG + Intronic
1064321627 10:14310533-14310555 GTTGAACATACCTGGCTTCCAGG - Intronic
1064983190 10:21184527-21184549 AATGAATGAACCTGGCTTCATGG + Intergenic
1065370419 10:24979489-24979511 CTTGAATTTTCTTGGCTTCCTGG + Intergenic
1066115057 10:32232545-32232567 TTGGAATGTACCTGGATTCCAGG - Intergenic
1067304179 10:45044522-45044544 ACTGAAGGTACCTGGCTTCCAGG + Intergenic
1067742176 10:48903997-48904019 AGTCACTCTACCTGGCTTCCAGG - Intronic
1068507100 10:57914945-57914967 GCTGAAAATACCTGGCTTCCAGG + Intergenic
1069180154 10:65348929-65348951 ATTAAATGTACCTGGCTTCCAGG + Intergenic
1069236875 10:66087021-66087043 GTTGGATGTACCTAGCTTCCAGG - Intronic
1071950082 10:90693204-90693226 GTTGAACATACCTGGCTTCCAGG + Intergenic
1074080098 10:110161587-110161609 ATTGAATGGTCCTGGCATCCTGG - Intergenic
1074623286 10:115149241-115149263 GTTGAATATACCTGGCTTCCAGG + Intronic
1074714927 10:116209517-116209539 ATTGAGTGGCCCTGCCTTCCTGG - Intronic
1074840548 10:117346672-117346694 ACTGAATGTACCTGGCTTCCAGG - Intronic
1075366122 10:121891421-121891443 ATTGAATATACCTGGCTTGCAGG + Intronic
1077028795 11:453999-454021 ATTGAACAGACCTGGCGTCCTGG + Intronic
1081616175 11:44592679-44592701 ATTGAAGATCTCTGGCTTCCTGG + Intronic
1082958349 11:58895823-58895845 GTTGAATATGCCTGGCTTCCAGG - Intronic
1083072295 11:59997806-59997828 TTGGAATCTTCCTGGCTTCCAGG - Intergenic
1083084660 11:60130169-60130191 GTTGAACATACCTGGCTTCCAGG + Intergenic
1085848862 11:80097200-80097222 GTGGGATGTACATGGCTTCCTGG - Intergenic
1088684366 11:112272520-112272542 CTGGAATGTAACTGGCTTTCTGG + Intergenic
1090878365 11:130811623-130811645 GTTGAACATACTTGGCTTCCAGG + Intergenic
1091877762 12:3950563-3950585 AATGGATCTACCTGGTTTCCTGG - Intergenic
1093071920 12:14714740-14714762 ATTGAATGTACCTGGCTTCCAGG + Intergenic
1094051156 12:26222209-26222231 ATTGAATGGAAATGGCTGCCTGG - Intronic
1094431675 12:30376586-30376608 GTTGAATGAACCTTGCATCCTGG + Intergenic
1097518855 12:60643512-60643534 GTTGAATATACCTGGCTTCCAGG + Intergenic
1097519548 12:60649400-60649422 GTTGAATATACCTGGCTTTAAGG + Intergenic
1097833060 12:64245861-64245883 TCTGAATGTACCTGAGTTCCTGG + Intergenic
1098010305 12:66043889-66043911 GCTGAACATACCTGGCTTCCAGG + Intergenic
1098720285 12:73888882-73888904 GTTGAACATACTTGGCTTCCAGG + Intergenic
1100870970 12:98909752-98909774 ATTGCATCTACCTGGCTAGCTGG - Intronic
1101480519 12:105092339-105092361 ATTGAATGTACCCGGGTTTCAGG - Intergenic
1104181373 12:126385123-126385145 ATTGAATATACCTGGCTTCCAGG - Intergenic
1104706026 12:130948225-130948247 GTTGAACATACCTGGCTTCCAGG - Intergenic
1106887519 13:34205605-34205627 GTTGAACATGCCTGGCTTCCAGG + Intergenic
1107084738 13:36414259-36414281 ATTGAATCAACCTTGCATCCTGG - Intergenic
1107891511 13:44918552-44918574 CTGGAATGTTCCAGGCTTCCGGG - Intergenic
1110017395 13:70424668-70424690 TTTGAACATACCTGGCTTCCAGG + Intergenic
1112163250 13:96890653-96890675 GTTGAACATACCAGGCTTCCAGG + Intergenic
1113128384 13:107006505-107006527 TTTGACTTTACCTGGATTCCAGG + Intergenic
1116812589 14:49553952-49553974 GTTGAACATACCTGGCTTCCAGG - Intergenic
1117755758 14:58972504-58972526 GTTGAACATACCTGGCTTCCAGG + Intergenic
1121262180 14:92574439-92574461 GTTAAACATACCTGGCTTCCAGG + Intronic
1124087591 15:26565622-26565644 GTTGAATGTAACTCACTTCCGGG + Intronic
1127026997 15:54817760-54817782 ATTGAGTGTACCAAGCTTACTGG - Intergenic
1127585605 15:60375054-60375076 AATGAATATACCTGGCGTGCAGG + Intronic
1127851492 15:62916184-62916206 GTTGAATATACCTGGCTTCCAGG - Intergenic
1127873645 15:63093703-63093725 ATTGCATGGACCTTGCTTTCCGG + Intergenic
1128337031 15:66793545-66793567 AGTGAATGCACCTTGCTTCCTGG + Intergenic
1130132623 15:81157072-81157094 AATGATGGTACCTGGCTTACAGG - Intergenic
1130132756 15:81158089-81158111 AATGATGGTACCTGGCTTACAGG + Intergenic
1130557361 15:84932041-84932063 ATTGACTGTCCCTGGCTGCTGGG - Intronic
1130772975 15:86943691-86943713 GTTGAATATACCTGGCTTCCAGG + Intronic
1132075547 15:98816916-98816938 AGTGAATGAACCTGGCTTTGAGG - Intronic
1132265665 15:100468436-100468458 AAAGAATGCAGCTGGCTTCCAGG + Intronic
1133870340 16:9680039-9680061 ATTGAACACACCTGGCTCCCAGG - Intergenic
1136126491 16:28186274-28186296 ATTGCTTTTACCTGGTTTCCAGG + Intronic
1138459072 16:57137438-57137460 CTTGATTGGTCCTGGCTTCCTGG + Intronic
1138709975 16:58960561-58960583 ATTGAATGTACCTGGCTTCCAGG - Intergenic
1139096852 16:63714995-63715017 GTTGAACATACCTGGCTTCCAGG - Intergenic
1139167138 16:64580642-64580664 ATTGATGGTACCTGGCTTCCAGG - Intergenic
1139235459 16:65333619-65333641 ATAGAATGTGCCTATCTTCCAGG - Intergenic
1140533955 16:75691998-75692020 GTTGAACCTAGCTGGCTTCCAGG - Intronic
1142804394 17:2363830-2363852 CTGGAATGGACCTGGCATCCAGG + Intronic
1144177351 17:12720036-12720058 TTTCAATATTCCTGGCTTCCAGG - Intronic
1149248050 17:54734999-54735021 GTTGAACATACCTGGCTTCTTGG - Intergenic
1151060019 17:71081006-71081028 GTTGAACACACCTGGCTTCCAGG - Intergenic
1152602758 17:81273221-81273243 AATGAATGGCCCTGGCATCCCGG - Intronic
1153550263 18:6255384-6255406 ATTGAAAGTACCAGGGTTGCTGG - Intronic
1156291370 18:35751208-35751230 GTTGAACATACCTGGCTTCCAGG + Intergenic
1157891029 18:51418184-51418206 ATTGAATGTACCTGACTTCCAGG - Intergenic
1158013819 18:52760810-52760832 AATTAATTTACTTGGCTTCCAGG - Intronic
1159328757 18:66959859-66959881 ATTGAAGCTATCTGTCTTCCAGG - Intergenic
1160600238 18:80006999-80007021 GTTGAACATACTTGGCTTCCAGG + Intronic
1160902682 19:1436585-1436607 AGGGAATGGAGCTGGCTTCCTGG - Intergenic
1164942666 19:32263697-32263719 GTTGAACATACCTGGCTTCCAGG + Intergenic
1165271550 19:34711961-34711983 ATTCAATGTACCTGGCTTCCAGG - Intergenic
1165636526 19:37344971-37344993 GTTCAATGTACAAGGCTTCCTGG - Intronic
1166255939 19:41604624-41604646 GTTGAACATACCTGGCTTCCAGG + Intronic
1166654687 19:44602118-44602140 GTTGAACATACCTGGCTTCCAGG - Intergenic
1166654958 19:44604258-44604280 GTTGAACATACCTGGCCTCCAGG + Intergenic
1168084863 19:54038189-54038211 GTTGAATATACCCGGCTCCCAGG - Intergenic
1168366171 19:55789674-55789696 GTTGAATGTATGTGGCTTCCCGG - Intronic
1168435285 19:56312013-56312035 ATTGATTTTACCGGGCTTCTGGG - Intronic
925102835 2:1263625-1263647 TTTGCAGCTACCTGGCTTCCTGG - Intronic
925292237 2:2755685-2755707 ATCGAATGTTCCTTGCTCCCTGG + Intergenic
926900974 2:17752120-17752142 ATTGACTGTACCTAGCTGACAGG - Intronic
929742186 2:44614435-44614457 ATTGAATGTGCCTGTTTTCCAGG + Intronic
929859131 2:45660870-45660892 ATTGTATGTTCCTGTCCTCCTGG - Intronic
933118503 2:78504322-78504344 GTTGAACATACCTGGCTTCCAGG + Intergenic
933447141 2:82395818-82395840 ATTGAACATAACTGGCTTCCAGG + Intergenic
935723275 2:105998259-105998281 GTTGAATGTACCTGGCTTCCAGG - Intergenic
938009573 2:127818257-127818279 GTTGAACATACCTGGCTTCAAGG - Intergenic
938010567 2:127825566-127825588 GTTGAACATACCTGGCTTCCAGG - Intergenic
940572486 2:155456213-155456235 ATAGAATGACCCTGGCTTTCAGG - Intergenic
940724204 2:157316192-157316214 ATTGAATGTGCCTGGCTTCCAGG + Intergenic
943123786 2:183771271-183771293 ATTAAATCTACCTGAGTTCCTGG - Intergenic
943283146 2:185963484-185963506 GTTGGATGTACCTGGCTTTTAGG + Intergenic
943415609 2:187599024-187599046 ATTGGATTTACCTGGATTCTAGG - Intergenic
943995174 2:194754254-194754276 ATTGAATATACCTGATCTCCAGG + Intergenic
944007289 2:194925078-194925100 TTGAAATGTACCTGGCTTCCAGG + Intergenic
945206804 2:207341373-207341395 ACTGAATGAAACCGGCTTCCTGG + Intergenic
948796983 2:240410349-240410371 ATTGAATGACCCAGGTTTCCCGG - Intergenic
1169782991 20:9329147-9329169 GTTGAACATACCTGGCTTCCAGG + Intronic
1170101131 20:12700810-12700832 ATGGAATGCACCTGGCTTCCAGG - Intergenic
1171279518 20:23883978-23884000 ATTGAGTGTAACAGGATTCCAGG - Intergenic
1176520130 21:7818145-7818167 ATTGAAGGTACCTGTCTTTTTGG + Exonic
1178522561 21:33298851-33298873 ATTGGATGTACTTGGCTTCCAGG - Intergenic
1178654156 21:34448157-34448179 ATTGAAGGTACCTGTCTTTTTGG + Intergenic
1179316965 21:40252636-40252658 CTTGCATGTACCTGGCCACCCGG - Intronic
1180117577 21:45721005-45721027 TTTGAAGGTACCTTGCTTTCTGG + Intronic
949091896 3:38756-38778 GTTGAATATACCTGATTTCCAGG + Intergenic
949222110 3:1648176-1648198 AATGAAGGCACTTGGCTTCCAGG + Intergenic
950784640 3:15423919-15423941 AGCCACTGTACCTGGCTTCCAGG - Intronic
953760734 3:45684808-45684830 ATTGGATGCACCTGTCTTCCAGG + Exonic
954741371 3:52753444-52753466 ATTCAATTTACCAGCCTTCCGGG - Intronic
955158237 3:56438816-56438838 AGTGAATTTACCTGCCTACCTGG + Intronic
956075797 3:65503916-65503938 ACTGAGAGCACCTGGCTTCCAGG - Intronic
957032207 3:75254982-75255004 GTTGAATATACCTGACTTCCAGG + Intergenic
957227927 3:77473327-77473349 GTTGAATAGACTTGGCTTCCAGG + Intronic
959265604 3:104133714-104133736 ATTGGGTGGACCTGGCTACCTGG - Intergenic
960564706 3:119120781-119120803 ATTGAATGTACCTGGCTTCCAGG + Intronic
960962428 3:123081710-123081732 ATTGAATATCTCTGGCTTCATGG + Intronic
961306488 3:125961352-125961374 AGTGGGTGTTCCTGGCTTCCAGG + Intergenic
961575555 3:127833194-127833216 AATGAAAGTAACTGGCTTCCCGG + Intergenic
962105187 3:132382487-132382509 ATCGAATGTATCTGGCTTCCAGG + Intergenic
963102208 3:141618527-141618549 TTTAAGTGGACCTGGCTTCCAGG - Intergenic
966191559 3:177276384-177276406 AGTGAATGTACCTCCCTCCCTGG - Intergenic
967061231 3:185874503-185874525 GTTGAATATTCCTGGCTTCCAGG + Intergenic
967256568 3:187598830-187598852 ATTTAATAAACCTGGCTTCCAGG + Intergenic
968121494 3:196129006-196129028 CTTGAATGTACCTGGAATCCTGG + Intergenic
968332112 3:197879685-197879707 ATTGAATGCATTTGGCTTCTGGG + Intronic
968806801 4:2778846-2778868 GTTGAACATACCTGGCTCCCAGG + Intergenic
969371257 4:6732938-6732960 GTTGACTGTACCTGGCTCCCTGG - Intergenic
970491106 4:16574498-16574520 AATGTATGGACTTGGCTTCCTGG + Intronic
973193444 4:47413032-47413054 GTTGAACATACCTGGCTTCCAGG + Intronic
974043093 4:56874557-56874579 GTTGAACATCCCTGGCTTCCAGG + Intergenic
974066440 4:57081880-57081902 ATTGAATCACCCTGCCTTCCTGG + Intronic
974946037 4:68529956-68529978 GTTGAATATACCTGGCTTCAAGG - Intergenic
974955790 4:68639754-68639776 GTTGAATATACCTGGCTTCAAGG - Intronic
975414789 4:74093814-74093836 CTTGACTGAACCTGGGTTCCAGG + Intergenic
975582995 4:75923493-75923515 TTTGAACATACCTGGCTCCCAGG - Intronic
976396965 4:84566266-84566288 ATTGAATATACCTGGCTTCCAGG + Intergenic
977684475 4:99832490-99832512 ATGGAATGTAGGTGGCTGCCTGG + Intronic
977962713 4:103103986-103104008 ACTCAATGTTCCTGGCTTCAGGG - Intergenic
978192753 4:105934372-105934394 ATTAAATGCATCTGGCATCCTGG - Intronic
979937407 4:126715346-126715368 ACTGAATGTACCTGGCCTCCAGG + Intergenic
980033057 4:127852765-127852787 GTTGAATATACCTGGCTTTCAGG - Intergenic
982693284 4:158571837-158571859 ATTGAATGTATCTGGCTTCCAGG - Intronic
984466291 4:180102689-180102711 ATTGCATGGACCTGGTATCCTGG + Intergenic
985926128 5:3020546-3020568 GTTGAACATACCTGGCTTTCAGG - Intergenic
986892288 5:12323756-12323778 ACTGAATGTACATGGCTTCCAGG - Intergenic
986919194 5:12663128-12663150 ATTGAATGTACCTGGCTTCCAGG + Intergenic
987163737 5:15172449-15172471 ATTGACTGGACCTGACATCCAGG - Intergenic
988196446 5:28011819-28011841 ATTGAATATACCTGGTTTACAGG - Intergenic
988476214 5:31588228-31588250 GTTGAACATACCTGGCTGCCAGG + Intergenic
988775552 5:34475238-34475260 GTTGAACATACCTGGCTTCCAGG - Intergenic
990724962 5:58743217-58743239 ATCTAATGTACCTGGCATCATGG + Intronic
995953731 5:117748566-117748588 ATTGAATTTACCTGGCTTCCAGG + Intergenic
996665706 5:126057470-126057492 ATTGAATGTTCCTGGCTTCCAGG + Intergenic
996689884 5:126329166-126329188 ATTCAAAGTACCTATCTTCCTGG + Intergenic
996907414 5:128616853-128616875 CTTGAATGTGCCTGTCTACCTGG + Intronic
997199604 5:132001859-132001881 ATTGTTTGTGCCTGGCTTCCTGG - Intronic
997662786 5:135602366-135602388 CTGGGATGGACCTGGCTTCCAGG + Intergenic
997858418 5:137394037-137394059 AATGAAGGTTCCTGGATTCCAGG + Intronic
1000509485 5:162164342-162164364 ATTGAATACACCTGGCTTCCAGG + Intergenic
1001504640 5:172268387-172268409 ATTAAATCTACCTGATTTCCAGG + Intronic
1002565677 5:180112032-180112054 AGGGACTGGACCTGGCTTCCAGG - Intronic
1003121437 6:3321997-3322019 ATTGCATGTACCAGGGTGCCCGG + Intronic
1005165638 6:22917003-22917025 GTTGAACATACCTGGTTTCCAGG + Intergenic
1005471781 6:26168044-26168066 ATTGAAGGTATCTGCTTTCCAGG + Intronic
1006288837 6:33118175-33118197 ATTGGATGTACCTGACTTCCAGG + Intergenic
1008258771 6:49339202-49339224 TTTGAATATACCTAGCTTCCAGG - Intergenic
1008259032 6:49342509-49342531 ATTGAATGTACTTGGCTTTCAGG - Intergenic
1010458999 6:76092138-76092160 ATTGAATGTAAGTGGCTTAATGG - Intergenic
1011986705 6:93456396-93456418 ATTGAATCTTCCAGGATTCCAGG + Intergenic
1013430483 6:110050954-110050976 ATTGACTGTACCTTGCTGCAAGG - Intergenic
1013766416 6:113579132-113579154 ATTGCATGTTCCTGTGTTCCAGG - Intergenic
1016285720 6:142470391-142470413 ATTGAATTTGCCTGGCTCTCAGG + Intergenic
1017925403 6:158907954-158907976 ATTGAATATACCTGGTCCCCAGG - Intronic
1019497910 7:1349092-1349114 ATTGTGTTTACCTGGCTTCGTGG - Intergenic
1020011092 7:4806095-4806117 GATGAATGTCCCTGCCTTCCAGG - Intronic
1020431197 7:8117960-8117982 ATACATTGTCCCTGGCTTCCAGG - Intronic
1020654003 7:10908601-10908623 ATTGAATGTACCTGGCTTCCAGG - Intergenic
1020784700 7:12558439-12558461 GTTGAATATACCTGGTTTCCAGG + Intergenic
1021880254 7:25088413-25088435 ATTGATTGAGCCTGGCTGCCTGG - Intergenic
1022846189 7:34212389-34212411 ATAGAGTGTACCTGGCTCCTGGG + Intergenic
1024119922 7:46226288-46226310 GTGGAATGTACCCGACTTCCTGG + Intergenic
1024501374 7:50111532-50111554 GTTGAATATACCTGGCTTCCTGG + Intronic
1026097789 7:67360513-67360535 GTTGAATATACCTGGCTTCCAGG - Intergenic
1026276496 7:68882286-68882308 GTTGAACATACCTGGCTTCCAGG - Intergenic
1026626277 7:71995262-71995284 GCTGAACGCACCTGGCTTCCAGG + Intronic
1027502357 7:78969058-78969080 ATTGAATGTACCTGGCTTCCAGG - Intronic
1028512341 7:91639088-91639110 ATAGATTCTACCTGGCTTGCTGG - Intergenic
1028734718 7:94195123-94195145 ATTGATTGTAGCTGGCATCTAGG - Intergenic
1029333917 7:99883756-99883778 GTTGGATGTACCTGGCTTCCAGG + Intronic
1029340998 7:99944545-99944567 GTTGAATATACCTGGCTTCCAGG + Intergenic
1029602354 7:101575193-101575215 GTTGAATATACCTAGCTTCCAGG - Intergenic
1030258493 7:107538107-107538129 GTTGAACATACCTGGCTTCCAGG - Intronic
1030296895 7:107938120-107938142 ATTGAATGTAATTGTCTTCTTGG + Intronic
1031930661 7:127682339-127682361 ATTCAAAGGACCTGGCTTCAGGG - Intronic
1032734475 7:134678692-134678714 CTGGAAAGTTCCTGGCTTCCAGG + Intronic
1033428931 7:141271012-141271034 ATTGAACATACCTGGCTTAGAGG - Intronic
1033874215 7:145794507-145794529 ATAGTGTGTACCTGGCCTCCAGG + Intergenic
1034857355 7:154564076-154564098 CCTGACTGTACCTGGCTTCCCGG - Intronic
1035703764 8:1658269-1658291 ATTGAATGTACCTGGCTTCCAGG + Intronic
1035705484 8:1671338-1671360 ATTCAATGGGACTGGCTTCCGGG + Intronic
1036129764 8:6098182-6098204 GTTGAACATACCTGGCTTCCAGG + Intergenic
1038348304 8:26752451-26752473 TTTGAATATAACTGGCTTCCAGG + Intronic
1040397687 8:47015115-47015137 GTTGACTATACCTGGCTTCCAGG + Intergenic
1042426162 8:68650877-68650899 GTTGAACATACCTGGCTTCCAGG + Intronic
1042656547 8:71104492-71104514 ACTGATTTTACCTGGCTGCCAGG + Intergenic
1043402135 8:79894191-79894213 ATTAATTGTGCCTGGCCTCCTGG + Intergenic
1044003259 8:86911135-86911157 GTTGAACATACCTGGTTTCCAGG + Intronic
1044136496 8:88592321-88592343 ATTGAATGTACCTGGCTTCTAGG + Intergenic
1045514478 8:102845340-102845362 ACTGAATGTAGTTGGCTTCTTGG - Intronic
1046193465 8:110830089-110830111 ATTAAATGTACCTGGTTTCCAGG + Intergenic
1046194078 8:110835756-110835778 ATTGAATGTACCTGGCTTCTAGG + Intergenic
1046544218 8:115627941-115627963 ACTGAATATACTTGGCTTACTGG - Intronic
1047356185 8:124124452-124124474 GTTGAACATACCTGGCTTCCAGG - Intergenic
1047467306 8:125129482-125129504 ATTTAATGGACCTGGGTTGCAGG - Intronic
1048319505 8:133387441-133387463 GTTGAACATACCTGGCTTCCAGG + Intergenic
1055443942 9:76364244-76364266 GTTGAATACACCTGCCTTCCAGG - Intergenic
1057073087 9:92117391-92117413 ATTGAACATACCTGGCTTCCAGG - Intergenic
1058110758 9:101029032-101029054 CCTGAATGTACCTCGCTCCCGGG + Exonic
1059527441 9:115005642-115005664 ATAGAATGTTCCTTGGTTCCCGG - Intergenic
1061554523 9:131358839-131358861 GTTGACTCTACCTGGCTCCCAGG + Intergenic
1185804662 X:3046241-3046263 GTTGAACATACCTGGCTTCCAGG + Intronic
1186302378 X:8214176-8214198 GTTGAGTATACCTGGCTTCCAGG - Intergenic
1187362832 X:18644103-18644125 ATTGAATGCACTTTGCTTCACGG - Intronic
1187941607 X:24388052-24388074 GTTGAACATAGCTGGCTTCCAGG + Intergenic
1188137935 X:26512696-26512718 GTTAAATATACCTGACTTCCAGG - Intergenic
1188833857 X:34932733-34932755 GTTGAATATACCTGGCTTCCAGG - Intergenic
1188988586 X:36790172-36790194 GTTGAATATACCTGACTTCCAGG - Intergenic
1188990445 X:36812489-36812511 GTTTAATGTACCTGGCTACTAGG - Intergenic
1189210763 X:39280261-39280283 GTTCAATGTTCCTGCCTTCCAGG - Intergenic
1192840806 X:74853487-74853509 ATTGAATGTACCTGGCTTCCAGG + Intronic
1196465344 X:115966878-115966900 ATTGAATGTGCCTATCATCCTGG + Intergenic
1196873976 X:120140415-120140437 ATTGAATGTACCTGGCTTCCAGG - Intergenic
1197046735 X:122006534-122006556 TCTGAAAGTAGCTGGCTTCCTGG - Intergenic
1197675593 X:129326492-129326514 ATTGAATTTACCTGGGTTCATGG - Intergenic
1199734638 X:150673906-150673928 ATTGAAAGAACCTCTCTTCCTGG + Intergenic
1201360969 Y:13148452-13148474 ATTGAATGTACCTGGCTTCCAGG - Intergenic
1201938042 Y:19428519-19428541 ATTGAATGTGCCTGGCTTCCAGG + Intergenic
1201938579 Y:19434166-19434188 ATTGAATGTACCTGGCTTCCAGG + Intergenic