ID: 909153164 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:72034925-72034947 |
| Sequence | ATTGAATGTACCTGGCTTCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 909153164_909153169 | 25 | Left | 909153164 | 1:72034925-72034947 | CCTGGAAGCCAGGTACATTCAAT | No data | ||
| Right | 909153169 | 1:72034973-72034995 | TCACCACGTTTATGGTGTCATGG | No data | ||||
| 909153164_909153167 | 17 | Left | 909153164 | 1:72034925-72034947 | CCTGGAAGCCAGGTACATTCAAT | No data | ||
| Right | 909153167 | 1:72034965-72034987 | CTTCCTTGTCACCACGTTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 909153164 | Original CRISPR | ATTGAATGTACCTGGCTTCC AGG (reversed) | Intronic | ||