ID: 909153166

View in Genome Browser
Species Human (GRCh38)
Location 1:72034933-72034955
Sequence ACTGCCATATTGAATGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 2, 2: 8, 3: 19, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909153166_909153171 28 Left 909153166 1:72034933-72034955 CCAGGTACATTCAATATGGCAGT 0: 1
1: 2
2: 8
3: 19
4: 103
Right 909153171 1:72034984-72035006 ATGGTGTCATGGCAGCCTCCAGG No data
909153166_909153167 9 Left 909153166 1:72034933-72034955 CCAGGTACATTCAATATGGCAGT 0: 1
1: 2
2: 8
3: 19
4: 103
Right 909153167 1:72034965-72034987 CTTCCTTGTCACCACGTTTATGG No data
909153166_909153169 17 Left 909153166 1:72034933-72034955 CCAGGTACATTCAATATGGCAGT 0: 1
1: 2
2: 8
3: 19
4: 103
Right 909153169 1:72034973-72034995 TCACCACGTTTATGGTGTCATGG No data
909153166_909153172 29 Left 909153166 1:72034933-72034955 CCAGGTACATTCAATATGGCAGT 0: 1
1: 2
2: 8
3: 19
4: 103
Right 909153172 1:72034985-72035007 TGGTGTCATGGCAGCCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909153166 Original CRISPR ACTGCCATATTGAATGTACC TGG (reversed) Intronic
906501862 1:46347130-46347152 CCTACCATATTAAATGTACCTGG - Intronic
909153166 1:72034933-72034955 ACTGCCATATTGAATGTACCTGG - Intronic
911070645 1:93829397-93829419 GATGCCATACTGAATGTACCTGG + Intronic
918645945 1:186904626-186904648 TCTGCCATTTTGAATGTTACAGG - Intronic
920613356 1:207464467-207464489 AGTGCCATATTGGATGTAATAGG + Intronic
923195882 1:231666899-231666921 ACTGCCATTTTGAATTTAAAGGG - Intronic
1063039540 10:2322726-2322748 ACCTCCATGTTGAATATACCTGG + Intergenic
1063795570 10:9510904-9510926 ACCTCCATGTTGAATATACCTGG + Intergenic
1064160732 10:12943526-12943548 ACCTCCATGTTGAATATACCTGG - Intronic
1064905729 10:20343590-20343612 ACCTCCATGTTGAATATACCTGG - Intergenic
1067172692 10:43921253-43921275 ACTGCCTTACCAAATGTACCTGG - Intergenic
1067304177 10:45044514-45044536 AATGCCATACTGAAGGTACCTGG + Intergenic
1067803652 10:49377699-49377721 AATGCCATCTTGTATATACCAGG + Intronic
1069180152 10:65348921-65348943 GACGCCATATTAAATGTACCTGG + Intergenic
1070550956 10:77490256-77490278 ACTCCCATAATGAATCTAACAGG + Intronic
1072436788 10:95421459-95421481 ACTGCCATTTTGCCTGTTCCTGG + Intronic
1072723459 10:97796034-97796056 ACTCCCATATTGCCTGCACCTGG + Intergenic
1072864986 10:99049605-99049627 ACTGACATATTCAAAGTACAAGG + Intronic
1089712116 11:120323061-120323083 ACTGCCCTTATTAATGTACCAGG - Intergenic
1093071918 12:14714732-14714754 GGTGCCATATTGAATGTACCTGG + Intergenic
1093818806 12:23585813-23585835 TCCTCCATGTTGAATGTACCTGG - Intronic
1096722284 12:53532298-53532320 ACTGCCATGGTCTATGTACCAGG + Intronic
1097156069 12:57013242-57013264 GCTGGCATATTGTTTGTACCAGG + Intronic
1097518852 12:60643504-60643526 ACCTCCATGTTGAATATACCTGG + Intergenic
1097519545 12:60649392-60649414 ACCTCCATGTTGAATATACCTGG + Intergenic
1097937406 12:65269070-65269092 ACTGTAATATTAAATTTACCAGG - Intergenic
1099153992 12:79151612-79151634 ACTGCAATATTGGCTGTACCTGG - Intronic
1101480524 12:105092347-105092369 GACCCCATATTGAATGTACCCGG - Intergenic
1103241414 12:119416468-119416490 ATGGCCATTTTGAATGTAGCTGG - Intronic
1103269584 12:119662098-119662120 ACCTCCATGTTGAATATACCTGG - Intergenic
1106630674 13:31468463-31468485 ACTTCCATGTTGAATATGCCCGG + Intergenic
1108347862 13:49564180-49564202 GTTGCCATATTGAAAGAACCGGG - Intronic
1108396975 13:49999052-49999074 AACCCCATATTGAATGTACCTGG - Intronic
1110371596 13:74747136-74747158 CCTCACATATTCAATGTACCAGG + Intergenic
1110435960 13:75478778-75478800 ACAGCCATATCAAATGAACCTGG + Intronic
1110736419 13:78942482-78942504 TCTGCTATATTGCATGTAGCAGG - Intergenic
1111173675 13:84563783-84563805 ACCTCCATGTTGAATATACCTGG + Intergenic
1111208543 13:85045695-85045717 AATGCCATTTTGTATCTACCAGG - Intergenic
1116990994 14:51276420-51276442 ACCTCCATATTTAATGCACCTGG - Intergenic
1120756272 14:88247304-88247326 ACTGCCATATTGGCTGTGTCTGG - Intronic
1126844378 15:52745441-52745463 ATCACCATATTGAATGTACCTGG - Intergenic
1128819446 15:70638675-70638697 ACTGCTTTAGTGAAGGTACCGGG - Intergenic
1130772972 15:86943683-86943705 ACCTCCATGTTGAATATACCTGG + Intronic
1202983427 15_KI270727v1_random:388456-388478 ACAGTCATATTGAGTGGACCTGG + Intergenic
1137835411 16:51587749-51587771 GCTGCCATCTTGAATGTTGCTGG + Intergenic
1144176136 17:12709499-12709521 ACTGCCATTGTAAATGCACCTGG - Intronic
1148935500 17:51161724-51161746 ACTGCCATGTATAATGTTCCTGG - Exonic
1164122140 19:22275523-22275545 ATTGCCATATTGGGTGGACCTGG + Intergenic
1165271553 19:34711969-34711991 ACCACCATATTCAATGTACCTGG - Intergenic
1166439042 19:42794524-42794546 ACTGCCATATTGGGAGTACCTGG + Intronic
1166474042 19:43105296-43105318 ACCGCCATATTGGGAGTACCTGG + Intronic
1166488007 19:43230375-43230397 ACCGCCATATTGGGAGTACCTGG + Intronic
1168084866 19:54038197-54038219 ACCTCCATGTTGAATATACCCGG - Intergenic
931104574 2:59041285-59041307 ACTGGCATAGTGAGTGCACCGGG - Intergenic
938645377 2:133325133-133325155 ACTGCCGTATTCAATCTACCTGG + Intronic
940112831 2:150172842-150172864 ACTGACATATTGAAAGTGCTGGG + Intergenic
940664994 2:156598154-156598176 ATGGCCCTATTAAATGTACCAGG - Intronic
940724202 2:157316184-157316206 ATCACCATATTGAATGTGCCTGG + Intergenic
943283144 2:185963476-185963498 ATTGCCATGTTGGATGTACCTGG + Intergenic
944352626 2:198746549-198746571 CCTGCCATTTTGCAAGTACCAGG + Intergenic
944903133 2:204236245-204236267 ACTGGCATTTTGAATGCATCTGG - Intergenic
947803973 2:232951836-232951858 ACTGCTATAGTCAATGTAACAGG + Intronic
1169518234 20:6341818-6341840 AGTTCCATATTGAATACACCAGG + Intergenic
1173034330 20:39394329-39394351 AGTGCCACATTTAAGGTACCAGG + Intergenic
1176191120 20:63810300-63810322 ACTGGCATTTTTAATGTTCCTGG - Intronic
1177716154 21:24841638-24841660 ACCGCCATATTGGGTGTACTTGG + Intergenic
1178522564 21:33298859-33298881 ACCTCCATATTGGATGTACTTGG - Intergenic
1182338450 22:29601025-29601047 AATGCCAAATTTAATGTTCCTGG - Intergenic
956334589 3:68149035-68149057 ACTGTAATACTGAGTGTACCTGG + Intronic
960564704 3:119120773-119120795 GACACCATATTGAATGTACCTGG + Intronic
961348525 3:126281993-126282015 CCTTCCCTGTTGAATGTACCTGG + Intergenic
962105185 3:132382479-132382501 GATGCCATATCGAATGTATCTGG + Intergenic
962174175 3:133135542-133135564 AATGCCAAATTGAATGCAACAGG + Intronic
964154458 3:153567792-153567814 ACTGCATTTTTGAATATACCTGG - Intergenic
967663796 3:192147429-192147451 ACTGCTATTCTGAATGTACATGG + Intronic
967999566 3:195195633-195195655 ACTGCCAGAGTGAAGGGACCAGG - Intronic
968171967 3:196518023-196518045 ACTGCCATATTGGGTGAACCTGG - Intergenic
972029040 4:34428940-34428962 ACTGCCAGTTTGAATGGACGGGG - Intergenic
973153559 4:46918779-46918801 ACTGCTATCATGAATGTTCCTGG - Intergenic
974647382 4:64712852-64712874 ACTGCCATATTGGGTGGACCTGG + Intergenic
975082817 4:70300812-70300834 ACTGCCAGTATGATTGTACCAGG + Intergenic
975271025 4:72433457-72433479 AATGTCATATTTAATATACCAGG - Intronic
975728482 4:77315529-77315551 ACTGCCATAGTGGATGGGCCAGG - Intronic
976396963 4:84566258-84566280 ATCACCATATTGAATATACCTGG + Intergenic
977742385 4:100502294-100502316 ACCTCCATGTTGAATATACCTGG + Intronic
979937405 4:126715338-126715360 GACGCCATACTGAATGTACCTGG + Intergenic
980033060 4:127852773-127852795 ACCTCCATGTTGAATATACCTGG - Intergenic
982666609 4:158272234-158272256 ACTGTTATAGTGAATGTGCCAGG - Intergenic
982693286 4:158571845-158571867 ATCGCCACATTGAATGTATCTGG - Intronic
986919192 5:12663120-12663142 GATGCCATATTGAATGTACCTGG + Intergenic
987355379 5:17059133-17059155 CCTGGCATATTCAATGTATCTGG + Intergenic
988196448 5:28011827-28011849 ACTACCATATTGAATATACCTGG - Intergenic
993725036 5:91357352-91357374 AATGCCTCAGTGAATGTACCTGG - Intergenic
995714935 5:115072956-115072978 ACCACCATATTGTGTGTACCTGG + Intergenic
996665704 5:126057462-126057484 GATGCCATATTGAATGTTCCTGG + Intergenic
996970278 5:129358749-129358771 ATTGCCACCTTGAATGTTCCTGG + Intergenic
1000509482 5:162164334-162164356 ACCTCCATATTGAATACACCTGG + Intergenic
1008259034 6:49342517-49342539 AACGCCATATTGAATGTACTTGG - Intergenic
1009839354 6:69047890-69047912 ACTGCTATATTGATTGTTCATGG - Intronic
1016914769 6:149234464-149234486 ACTGCCATCTTGTATGTATTAGG + Intronic
1020610763 7:10394888-10394910 ACTTCCATATTGAATGCCCTTGG + Intergenic
1020654005 7:10908609-10908631 GATGCCACATTGAATGTACCTGG - Intergenic
1020784697 7:12558431-12558453 ACCTCCATGTTGAATATACCTGG + Intergenic
1023940172 7:44764289-44764311 ACTGAGATACTGCATGTACCAGG - Intronic
1025734929 7:64138388-64138410 CCTGCCATGTTAAATGTAGCTGG + Intronic
1026097791 7:67360521-67360543 ACTTCCATGTTGAATATACCTGG - Intergenic
1026160631 7:67865462-67865484 CCTGCCATGTTAAATGTAGCTGG + Intergenic
1027502359 7:78969066-78969088 ATCGCCATATTGAATGTACCTGG - Intronic
1029333914 7:99883748-99883770 ACCTCCATGTTGGATGTACCTGG + Intronic
1029340995 7:99944537-99944559 ACCTCCATGTTGAATATACCTGG + Intergenic
1035703762 8:1658261-1658283 GATGCCATATTGAATGTACCTGG + Intronic
1036935107 8:12994071-12994093 ACTGCCACAGTCAATGTGCCTGG + Intronic
1039407238 8:37323899-37323921 ACTGCCCCATTGAATGCAGCAGG + Intergenic
1040397685 8:47015107-47015129 ACTTCCATGTTGACTATACCTGG + Intergenic
1044136495 8:88592313-88592335 GATGGCATATTGAATGTACCTGG + Intergenic
1046193462 8:110830081-110830103 ACCGCCATATTAAATGTACCTGG + Intergenic
1046194076 8:110835748-110835770 ACTACCATATTGAATGTACCTGG + Intergenic
1050181188 9:2924420-2924442 ACTGCAATATAGACTGTGCCTGG + Intergenic
1052677990 9:31651324-31651346 ACTTCCATGTTGGATATACCTGG + Intergenic
1055082762 9:72283282-72283304 ACTGGTAAATTGAGTGTACCTGG - Intergenic
1058951132 9:109905213-109905235 ACTCCCATAATAAATGTACTGGG + Intronic
1185969220 X:4643188-4643210 ACTGCTATATTGAAGCTAACTGG + Intergenic
1186642418 X:11470205-11470227 ACTGACATTTTGAAAGTATCTGG - Intronic
1188592554 X:31855858-31855880 ACTGACATATTGAGTAAACCAGG - Intronic
1191204201 X:57816965-57816987 ACTGCCATGTTGGTTGGACCTGG + Intergenic
1192182439 X:68924628-68924650 CCTGCCGTATGGAATGTGCCAGG + Intergenic
1192265791 X:69537154-69537176 CCTGCCACAGTGAATGTAACAGG - Intergenic
1192840804 X:74853479-74853501 GATGCCACATTGAATGTACCTGG + Intronic
1196873978 X:120140423-120140445 ATCGCCATATTGAATGTACCTGG - Intergenic
1197445407 X:126547405-126547427 AGTGACATGTTGAATGTAGCTGG + Intergenic
1201360971 Y:13148460-13148482 AATGCCATATTGAATGTACCTGG - Intergenic
1201938040 Y:19428511-19428533 AATGCCATATTGAATGTGCCTGG + Intergenic
1201938577 Y:19434158-19434180 ATCACCATATTGAATGTACCTGG + Intergenic