ID: 909153167

View in Genome Browser
Species Human (GRCh38)
Location 1:72034965-72034987
Sequence CTTCCTTGTCACCACGTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909153162_909153167 29 Left 909153162 1:72034913-72034935 CCAGCAGCTGTACCTGGAAGCCA 0: 5
1: 6
2: 5
3: 26
4: 204
Right 909153167 1:72034965-72034987 CTTCCTTGTCACCACGTTTATGG No data
909153166_909153167 9 Left 909153166 1:72034933-72034955 CCAGGTACATTCAATATGGCAGT 0: 1
1: 2
2: 8
3: 19
4: 103
Right 909153167 1:72034965-72034987 CTTCCTTGTCACCACGTTTATGG No data
909153164_909153167 17 Left 909153164 1:72034925-72034947 CCTGGAAGCCAGGTACATTCAAT 0: 12
1: 14
2: 23
3: 64
4: 161
Right 909153167 1:72034965-72034987 CTTCCTTGTCACCACGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909153167 Original CRISPR CTTCCTTGTCACCACGTTTA TGG Intronic
No off target data available for this crispr