ID: 909154118

View in Genome Browser
Species Human (GRCh38)
Location 1:72049063-72049085
Sequence ACATTTAAACAGAAACTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909154117_909154118 -1 Left 909154117 1:72049041-72049063 CCAAAATTTCTCTGAGGAAGTGA No data
Right 909154118 1:72049063-72049085 ACATTTAAACAGAAACTAGAAGG No data
909154115_909154118 16 Left 909154115 1:72049024-72049046 CCACTTTAGAGTGGCTACCAAAA No data
Right 909154118 1:72049063-72049085 ACATTTAAACAGAAACTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909154118 Original CRISPR ACATTTAAACAGAAACTAGA AGG Intronic
No off target data available for this crispr