ID: 909154469

View in Genome Browser
Species Human (GRCh38)
Location 1:72054910-72054932
Sequence TAATTATCCTGGGGGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909154463_909154469 24 Left 909154463 1:72054863-72054885 CCTTTGAGAAGTTATGATTTATA 0: 1
1: 0
2: 1
3: 25
4: 327
Right 909154469 1:72054910-72054932 TAATTATCCTGGGGGATCAAAGG 0: 1
1: 0
2: 1
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909154469 Original CRISPR TAATTATCCTGGGGGATCAA AGG Intronic
904510927 1:31007019-31007041 GAATATTCCTGGGTGATCAATGG - Exonic
905034360 1:34907577-34907599 TCATTTCCCTGGGGGTTCAAAGG - Intronic
906431365 1:45758349-45758371 TAAATTTCCTGAGGGAACAAGGG - Intergenic
907449943 1:54539417-54539439 TAATTATGCTGAGTGAACAAAGG + Intergenic
909123848 1:71639914-71639936 CAATTATCCTTGGGAATGAATGG - Intronic
909154469 1:72054910-72054932 TAATTATCCTGGGGGATCAAAGG + Intronic
911739281 1:101369532-101369554 TAATTATCCTAGGGCAAAAATGG + Intergenic
913696042 1:121326773-121326795 TTGTTATCCTGGGGGATTTAGGG - Intronic
918645122 1:186895086-186895108 TAATTATCATGGAGACTCAAAGG - Intronic
919422773 1:197391308-197391330 AAATTAGCCTGTGGGATCAATGG - Intronic
921529811 1:216267837-216267859 TATGTATACTGTGGGATCAATGG - Intronic
1063185741 10:3649603-3649625 AAATTATGCTGTGGGATAAAAGG - Intergenic
1072200416 10:93152750-93152772 AAATAATCATGGGGGATCACAGG + Intergenic
1075490108 10:122859479-122859501 TCTTGATCCTGGAGGATCAAAGG + Intronic
1076140708 10:128076931-128076953 TAATTCTCCTGAGAGATAAATGG - Intronic
1078661493 11:13290445-13290467 TGATTAGCCTGGGGGATTCATGG + Intronic
1079648376 11:22895534-22895556 TTATTATCCTGTGGGTCCAATGG + Intergenic
1080653902 11:34243559-34243581 GGATTATCCTTGCGGATCAAAGG - Intronic
1083090182 11:60191559-60191581 GAACTATACTGGGAGATCAATGG + Intergenic
1090421587 11:126579151-126579173 TGATGATCCTGGAGGATGAACGG + Intronic
1090796826 11:130142518-130142540 TATTTATATTTGGGGATCAAGGG - Intronic
1092842758 12:12559086-12559108 TCATTATCCTTGATGATCAAGGG - Intronic
1095123765 12:38450047-38450069 TATTCACCATGGGGGATCAAGGG - Intergenic
1095392925 12:41729890-41729912 TTTTTTTCCTGGGGGAACAATGG - Intergenic
1095604414 12:44049991-44050013 TGATTAGCCTGGGGGATCAAGGG + Intronic
1098526794 12:71495782-71495804 TACTTCTCCTGGGGTTTCAAAGG - Intronic
1101347533 12:103900578-103900600 TAATTCACCTGAGGGATCTAGGG + Intergenic
1101815915 12:108146201-108146223 TAATTATCTTGGGGGATGGAAGG - Intronic
1103221739 12:119252125-119252147 CAATTTTCCTGGTGAATCAATGG - Intergenic
1108764444 13:53609515-53609537 TAATTATCTTGGGGAAGGAAAGG - Intergenic
1110126434 13:71948716-71948738 TAATTATCCTGGAGGGTAAAGGG - Intergenic
1112156678 13:96824896-96824918 TATACATCCTGGGGAATCAAAGG + Intronic
1112555158 13:100460728-100460750 TAATTGTGCTGGTGTATCAAGGG - Intronic
1113669670 13:112167055-112167077 GAATTATCCAGGGGGTGCAATGG + Intergenic
1114396202 14:22364371-22364393 TAATTTGCCTGGAAGATCAAGGG - Intergenic
1116030889 14:39569959-39569981 TAATATTCCTGGGGTAGCAATGG - Intergenic
1120050246 14:79857594-79857616 ATAGTGTCCTGGGGGATCAAAGG - Intronic
1135874772 16:26188247-26188269 CAAATATCCTGGGGGAACAGGGG - Intergenic
1138403321 16:56767170-56767192 TAATTATCCTGGAGGACAGAAGG + Intronic
1140257387 16:73348998-73349020 TTATTATCCTGGGGGTCCACAGG + Intergenic
1140553339 16:75892125-75892147 AAATTATTCTGGGAAATCAATGG + Intergenic
1142476608 17:192874-192896 TCATTGTCCTGTGGGTTCAAGGG - Intergenic
1142828566 17:2530451-2530473 TACTGACCCTGGGAGATCAAGGG + Intergenic
1155184177 18:23372881-23372903 TAATAATGCTGGGGGAGAAAAGG + Intronic
1158639389 18:59190468-59190490 TGATGATTCTGGGGGCTCAATGG - Intergenic
1161110765 19:2468590-2468612 TAACCACCCTGGGGGATCACTGG + Intergenic
1161604443 19:5206835-5206857 TACTCATCCTGGGGGAGCAGAGG + Exonic
1161998114 19:7726937-7726959 TAATAATCCCTGTGGATCAAGGG + Intergenic
1164029700 19:21392407-21392429 AAATTAACCTGGGAGTTCAAAGG - Intergenic
1165280938 19:34796632-34796654 TAAATATCCTGGGTGAACAGGGG + Intergenic
926078873 2:9967223-9967245 TGACTCTCCTGGGGGATCAAGGG - Intronic
926689221 2:15721544-15721566 TAATTATTCTGGGACACCAAGGG + Intronic
927248318 2:20976089-20976111 CAATTCTCCTGGGGGTGCAAGGG + Intergenic
928739912 2:34339056-34339078 TCATGATCCTGGGGAATCCATGG - Intergenic
930081409 2:47452063-47452085 TAATGATGCTGTGGGATTAAAGG + Intronic
933619272 2:84518482-84518504 TAATTATCCAAGGGCATAAATGG - Intronic
933621768 2:84551365-84551387 TAATTATCTTTGGGTAGCAAAGG - Intronic
938782750 2:134600307-134600329 TCATTATCCTGTTGGATCAGAGG - Intronic
939597025 2:144137960-144137982 TAATTATCCTGTGGAACAAAGGG - Intronic
940367039 2:152859997-152860019 TAATTATATTGTGGGAACAAGGG - Intergenic
944356738 2:198798575-198798597 TAATTTTCCTGGGGAAAAAAAGG + Intergenic
945780839 2:214169840-214169862 TAATTATCCTGGGGATAAAAAGG + Intronic
1169058000 20:2639772-2639794 AAAATATCCTGGGGCTTCAAAGG + Intronic
1170245925 20:14221210-14221232 TACTTATCTTGGGGTATGAATGG + Intronic
1170385557 20:15812357-15812379 TAACTATTATGGAGGATCAATGG - Intronic
1171137732 20:22712129-22712151 TAATCATCCTCAGGGATTAATGG + Intergenic
1174529117 20:51196988-51197010 TTGTTATCCTGGAGGGTCAAAGG - Intergenic
1183226473 22:36553596-36553618 TAGTTATCCTGGGTGAGCAAGGG - Intergenic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
950319964 3:12042487-12042509 GAATTATCCTGGGAGCTCAATGG + Intronic
950948892 3:16979245-16979267 AAAATACCCTGGGGGATGAAGGG - Intronic
951689380 3:25379906-25379928 TAACTTTCCTTGGGGGTCAAGGG + Intronic
955353322 3:58209925-58209947 TAATTAACCTGTAGGATAAAGGG + Intronic
958910136 3:99985162-99985184 AAATCATCCTAGGGGGTCAAAGG + Intronic
959208782 3:103348151-103348173 TATTTATACTGAAGGATCAAAGG + Intergenic
960365957 3:116772606-116772628 TAAATATTTTGGGGGATAAAAGG - Intronic
960519708 3:118640836-118640858 TAATTAACCTTGGGGTCCAAAGG + Intergenic
960945382 3:122962829-122962851 TAATTTTCATGGGGGGTCAGGGG - Intronic
964914642 3:161825626-161825648 TAATTATCCTTAGGAAACAAAGG + Intergenic
966479126 3:180385477-180385499 TGATCATTCTGGGGTATCAATGG - Intergenic
967307315 3:188071699-188071721 TAATTAACCTGGTGCATCATAGG - Intergenic
967420173 3:189263658-189263680 TAATTATCCTGAGAGATAAGTGG - Intronic
967699078 3:192570514-192570536 TAATTAGGCTGAGAGATCAAAGG - Intronic
970894622 4:21087602-21087624 TAATTATCCTGTGGGAGTCAAGG + Intronic
971508112 4:27388634-27388656 TAATTATCCTGTGGTCTCATAGG + Intergenic
972781669 4:42291870-42291892 CAATTTTCCTGGGGAATCCAAGG - Intergenic
976905764 4:90234125-90234147 TATTTATACAGGGGGATCTAGGG + Intronic
977371391 4:96141609-96141631 TAATCATCATGGGGCATCAGGGG + Intergenic
981594438 4:146403375-146403397 TAAGTTTCCTGGGGGAAAAATGG - Intronic
982973280 4:162018160-162018182 TAATTTTCCTAGGGGGTAAATGG + Intronic
983463245 4:168053202-168053224 TAATTTTCCTTGTGGATCTAAGG - Intergenic
986941558 5:12956661-12956683 TAATTATACTGTGGGATGGAAGG + Intergenic
987726363 5:21705009-21705031 TAATTATTCTGGTGGATAAATGG - Intergenic
988045983 5:25953885-25953907 TCATTATCCTCAGGGATCAAGGG - Intergenic
992991115 5:82284864-82284886 TCTTTATCCTGGGGGATGGATGG + Intronic
996330241 5:122320613-122320635 TAAACATCCTGGGGGAAGAAAGG - Intronic
997533113 5:134594804-134594826 AGACTATCCTGGGGGATCACTGG + Intergenic
998098856 5:139415288-139415310 TATTTAGCCAGGGGGAACAATGG + Intronic
1003249175 6:4410389-4410411 TAAATATCATGTGGAATCAAAGG + Intergenic
1006453147 6:34116994-34117016 TGATTATCCTTGGGGAGGAAAGG + Intronic
1008081703 6:47202093-47202115 TAAAATTCCTGGGGTATCAAAGG + Intergenic
1008515741 6:52317451-52317473 TAAACATCCTGGTGGAGCAAAGG + Intergenic
1015656006 6:135519906-135519928 TAATTATTCTGGGACAGCAAGGG - Intergenic
1018099321 6:160422115-160422137 TAATTTTCCTGGTGGGTCCAAGG - Intronic
1019935811 7:4256855-4256877 AAAATGTCCTGGGGGATAAAAGG - Intronic
1020637077 7:10709736-10709758 TTATTATCCTGGGGAAAGAAGGG + Intergenic
1021134170 7:16945416-16945438 TAATTATCCAGAGGGAGCAATGG - Intergenic
1021616545 7:22507796-22507818 TAATGCTCCTTGGGGATCATGGG - Intronic
1022232922 7:28431396-28431418 TAACTGTCTTGGGGGAACAATGG - Intronic
1022926349 7:35059005-35059027 TAATGCTCCTTGGGGATCATGGG - Intergenic
1024849899 7:53700031-53700053 TTATTTTCCTGGGGTAACAAAGG + Intergenic
1028323761 7:89496411-89496433 AAATTATACTGGAGGACCAAGGG - Intergenic
1028375913 7:90146541-90146563 TAATGCTCCTTGGGGATCATGGG + Intergenic
1032303910 7:130714759-130714781 TAAACATTCTGGGGAATCAAAGG + Intergenic
1032936290 7:136735967-136735989 GAATGATCCTAGGGAATCAATGG + Intergenic
1033823378 7:145160606-145160628 TAATAAACCTGGTGTATCAAAGG - Intergenic
1034136262 7:148773063-148773085 TAATTATCATGAGGGATGAATGG - Intronic
1035692193 8:1567582-1567604 TAATGATCCTGGGGGACCCGTGG - Intronic
1040458417 8:47622692-47622714 TAGTTATCCTGGTGGATGAAAGG - Intronic
1041151355 8:54938313-54938335 TAATTATATTGTGGGAACAAGGG - Intergenic
1041423427 8:57694488-57694510 TAATTATACTGGGGCAGCAGGGG + Intergenic
1041945811 8:63441496-63441518 TTATTTTCCTGGGGTATGAAAGG + Intergenic
1045084906 8:98671824-98671846 TAATAATCCTCAGGTATCAAGGG + Intronic
1046782665 8:118232278-118232300 AAATCATCCTGGGGGATCAGAGG + Intronic
1047103931 8:121712385-121712407 TAATTTTCCTGGATGATTAAGGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1051059005 9:13024604-13024626 TGATCATACTGGGTGATCAATGG + Intergenic
1052600512 9:30622688-30622710 TAAATATCAAGGGAGATCAAAGG + Intergenic
1055967831 9:81882613-81882635 TGATTTGCCTGGGGGATCAGTGG - Intergenic
1057570713 9:96202362-96202384 TCATTCTCCTGGGGTCTCAATGG - Intergenic
1058879017 9:109270630-109270652 TAATTAGACTAGGGGATGAATGG - Intronic
1186570128 X:10706270-10706292 TACTTAGCCTGGGGAAGCAAGGG + Intronic
1190514946 X:51214145-51214167 TACTTCTCCTGGGGTTTCAAAGG - Intergenic
1192351839 X:70362337-70362359 TAATTCTCCTTGGTGATCACCGG + Intronic