ID: 909154996

View in Genome Browser
Species Human (GRCh38)
Location 1:72062781-72062803
Sequence ACACCCACTTCATATTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909154996_909154999 4 Left 909154996 1:72062781-72062803 CCTGTGAAATATGAAGTGGGTGT 0: 1
1: 0
2: 1
3: 16
4: 185
Right 909154999 1:72062808-72062830 CAAGATAGCTTGTCTTGCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 88
909154996_909155002 26 Left 909154996 1:72062781-72062803 CCTGTGAAATATGAAGTGGGTGT 0: 1
1: 0
2: 1
3: 16
4: 185
Right 909155002 1:72062830-72062852 GAAACCAGGGACTGCCCACATGG 0: 1
1: 0
2: 1
3: 14
4: 180
909154996_909155001 13 Left 909154996 1:72062781-72062803 CCTGTGAAATATGAAGTGGGTGT 0: 1
1: 0
2: 1
3: 16
4: 185
Right 909155001 1:72062817-72062839 TTGTCTTGCAAAGGAAACCAGGG No data
909154996_909155000 12 Left 909154996 1:72062781-72062803 CCTGTGAAATATGAAGTGGGTGT 0: 1
1: 0
2: 1
3: 16
4: 185
Right 909155000 1:72062816-72062838 CTTGTCTTGCAAAGGAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909154996 Original CRISPR ACACCCACTTCATATTTCAC AGG (reversed) Intronic
904281909 1:29426576-29426598 ACACCCACTTCTCCTTTCTCTGG - Intergenic
904980175 1:34493813-34493835 TCACCCACTTCATGTTTAAATGG + Intergenic
905520945 1:38599186-38599208 ACACCCACTGCATACTTCCCTGG + Intergenic
907719813 1:56961162-56961184 ATACACACTTCATATTACAGAGG - Intronic
909154996 1:72062781-72062803 ACACCCACTTCATATTTCACAGG - Intronic
912563764 1:110570216-110570238 ACCCCCACTTCCCAATTCACTGG - Intergenic
913658442 1:120983833-120983855 ACACCATTTTCATATTACACTGG + Intergenic
914009808 1:143766942-143766964 ACACCATTTTCATATTACACTGG + Intergenic
914648428 1:149675603-149675625 ACACCATTTTCATATTACACTGG + Intergenic
920775194 1:208929431-208929453 AAAACCACTGCATATTTCACTGG + Intergenic
920782436 1:209007145-209007167 ACAAGCACTTCTTATTTCACGGG - Intergenic
922251081 1:223849051-223849073 AAACCTACTTCATATTCCACTGG + Intergenic
1067902018 10:50251785-50251807 ACACCTACTTCATTTAACACTGG + Intergenic
1069813955 10:71181610-71181632 ACACCCACACCAGCTTTCACAGG + Intergenic
1072038486 10:91585965-91585987 TCCCCCACTTCATGTTTCATTGG + Intergenic
1072253658 10:93601016-93601038 ACACCCACTTCATCTTGCCCAGG + Exonic
1075886334 10:125902519-125902541 AGAGGCACTTCAAATTTCACTGG - Intronic
1075965742 10:126610117-126610139 AGATCCACTTCATCCTTCACAGG + Intronic
1078704672 11:13731027-13731049 ACACAAACTTCTTATTTAACAGG + Exonic
1081206362 11:40280378-40280400 AGACCCATTTCACAATTCACTGG + Intronic
1081449018 11:43155165-43155187 TCTCCCACTGGATATTTCACAGG - Intergenic
1086222273 11:84462546-84462568 ACAAACCCTTCATGTTTCACAGG + Intronic
1086365762 11:86109053-86109075 GCAGCTACTTCATATTTCAAAGG + Intergenic
1087500058 11:98939478-98939500 ATACCCACTCTCTATTTCACAGG + Intergenic
1088095027 11:106089187-106089209 ACATCCCCTTAATACTTCACTGG - Intronic
1091757156 12:3061409-3061431 ACACACACTTAGTATCTCACAGG - Intergenic
1093597289 12:20977243-20977265 AAACCTACTTTAAATTTCACAGG - Intergenic
1096133623 12:49181059-49181081 ACAACCACTTCATATTAGAATGG + Intergenic
1096201175 12:49684413-49684435 ACACCAACTTGACATTTCCCTGG + Intronic
1096588855 12:52644026-52644048 ACAGCCACTTCTATTTTCACAGG - Intergenic
1101096549 12:101347761-101347783 ACACACCATTCATATTTCAATGG - Intronic
1101341721 12:103847933-103847955 ACCCCCAATTCACATTCCACTGG - Intergenic
1104075661 12:125387494-125387516 AGCCCCACTTCACATGTCACAGG + Intronic
1104433015 12:128732228-128732250 ACCCCCACTACAGATTGCACTGG - Intergenic
1107278055 13:38699940-38699962 TCACACATTTCATATTTCATCGG - Intronic
1109086545 13:57979576-57979598 ACACCAACTACATATTCCACAGG + Intergenic
1114359690 14:21958046-21958068 ACACCAAATTTATAATTCACTGG - Intergenic
1115169118 14:30483418-30483440 ACAGCCACTTTATTTTTCATGGG - Intergenic
1115370996 14:32614821-32614843 AGACTCTCTTCATATCTCACTGG - Intronic
1115870757 14:37799957-37799979 ACACACATTTCTTATCTCACAGG - Intronic
1118507982 14:66436252-66436274 AGATCCACTTCATATTTCACCGG - Intergenic
1119658120 14:76431935-76431957 ACTGGCACTTCAGATTTCACAGG - Intronic
1121292401 14:92786743-92786765 ACAGCCACATAATATTCCACTGG + Intergenic
1202871744 14_GL000225v1_random:171402-171424 AAAGGCACTTCAAATTTCACTGG + Intergenic
1127354375 15:58184103-58184125 ACACTGAGTTCATATTTCTCTGG - Exonic
1128187042 15:65651248-65651270 AAACCTCCTGCATATTTCACAGG + Intronic
1130825570 15:87541886-87541908 ACAGCCACATAATATTTCATTGG + Intergenic
1133436796 16:5786726-5786748 ACAGCCATTTCACATTTGACTGG + Intergenic
1134745875 16:16587842-16587864 AGACCCACATTCTATTTCACAGG - Intergenic
1134910496 16:18021760-18021782 AACCCCAATTTATATTTCACAGG - Intergenic
1134999604 16:18765900-18765922 AGACCCACATTCTATTTCACAGG + Intergenic
1139644723 16:68320028-68320050 ACACCCACTGTATATGTGACAGG - Intronic
1141019400 16:80480715-80480737 ATCACCATTTCATATTTCACAGG - Intergenic
1142168628 16:88607718-88607740 ACACACACTTCATGTCTCTCAGG + Intronic
1142168632 16:88607758-88607780 ACACACACTTCATGTCTCTCAGG + Intronic
1142254701 16:89008093-89008115 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254716 16:89008160-89008182 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254724 16:89008194-89008216 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254733 16:89008229-89008251 ACACCCACCTCATCTTTGTCAGG + Intergenic
1142254739 16:89008264-89008286 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254747 16:89008298-89008320 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254756 16:89008333-89008355 ACACCCACCTCATCTTTGTCAGG + Intergenic
1142254762 16:89008368-89008390 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254785 16:89008470-89008492 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254794 16:89008504-89008526 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254808 16:89008568-89008590 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254816 16:89008603-89008625 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254830 16:89008671-89008693 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254839 16:89008706-89008728 ACACCCACCTCATCTTTGTCAGG + Intergenic
1142254845 16:89008741-89008763 ACACCCACCTCATCTTTTCCAGG + Intergenic
1142254875 16:89008876-89008898 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254883 16:89008911-89008933 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254905 16:89009013-89009035 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254920 16:89009080-89009102 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254935 16:89009147-89009169 ACACCCACCTCATCTTTGCCAGG + Intergenic
1142254948 16:89009214-89009236 ACACCCACCTCATCTTTGCCAGG + Intergenic
1144224485 17:13131686-13131708 ACACCCATTTATTATTTCACAGG - Intergenic
1146307703 17:31743282-31743304 ACACACACATTCTATTTCACTGG - Intergenic
1146614468 17:34343275-34343297 ATACTAACTTCATTTTTCACAGG + Intergenic
1149115581 17:53091435-53091457 ACGCCCAATTCATCTTGCACAGG + Intergenic
1151526801 17:74675573-74675595 ACACACACTACCTATTTCACAGG + Intronic
1153560100 18:6363016-6363038 ACAGCCCCTCCATTTTTCACAGG - Intronic
1155479219 18:26267312-26267334 ACACTCATTTCATATTTCTAAGG - Intronic
1156534669 18:37850930-37850952 AGATCCACATCATATTACACTGG + Intergenic
1157181132 18:45499097-45499119 CCACCACCTTCATTTTTCACTGG + Intronic
1157206881 18:45708195-45708217 ATACCCAGTTCAAATGTCACTGG + Intergenic
1160290908 18:77592096-77592118 TCTCCCACTTCAAATTTCAGTGG - Intergenic
1160401187 18:78612573-78612595 AAACCCAGTCCATGTTTCACAGG + Intergenic
1166663746 19:44664573-44664595 ACACCCACCTCATATTCCATGGG + Intronic
1168633681 19:57976996-57977018 ACACAGACTTCATATTCCAAAGG + Intergenic
925191238 2:1885494-1885516 ACACCCATGTCATCTTTTACAGG - Intronic
926227558 2:10979050-10979072 ACACCCACTTCATATGGCAAGGG + Intergenic
931688955 2:64818902-64818924 AAAACCACTTCGTAGTTCACAGG - Intergenic
932741384 2:74293468-74293490 AGACCCAATTCAAAATTCACAGG - Intronic
933242059 2:79932935-79932957 ACACACACTTCAAAGATCACAGG - Intronic
935097215 2:99957068-99957090 AGACCCCTTTCAGATTTCACAGG - Intronic
935488851 2:103692437-103692459 ATACCACCATCATATTTCACAGG - Intergenic
935626573 2:105176664-105176686 GCACACACTTCACAGTTCACTGG + Intergenic
936468753 2:112778093-112778115 GCACCCATGTCAAATTTCACTGG + Exonic
937129442 2:119496628-119496650 AGTCCCACCTCATATATCACAGG + Intronic
940389648 2:153117391-153117413 ATACCCACTCTATATTTGACAGG - Intergenic
941698420 2:168577753-168577775 ATGCCCATTTCCTATTTCACTGG - Intronic
944531329 2:200670402-200670424 AGACCCACTCCACTTTTCACTGG + Intronic
945638341 2:212388086-212388108 ACACCCATTTCAGATATCAAGGG - Intronic
947869291 2:233424053-233424075 ACCCCCTCTTCACTTTTCACGGG - Intronic
948354283 2:237365593-237365615 AAATCCTCTTCATGTTTCACTGG - Intronic
1169539421 20:6583058-6583080 CCACTCACTTCATTTTTCAAGGG - Intergenic
1173998612 20:47358204-47358226 ACAACCAGTTAATATTTTACTGG - Intergenic
1176697416 21:9996966-9996988 ACATCCACGTCATTTTGCACTGG + Intergenic
1177086883 21:16716681-16716703 ACACCAATGTCATTTTTCACAGG - Intergenic
1177514144 21:22125586-22125608 ACACTAAATTCATATTTCATGGG + Intergenic
1177905676 21:26968407-26968429 ACACCACATTCATTTTTCACTGG - Intergenic
1180253905 21:46609286-46609308 ACAGACACTTCAAATATCACTGG - Intergenic
1180286347 22:10748037-10748059 AAAGGCACTTCAAATTTCACTGG - Intergenic
1180665426 22:17507074-17507096 ACTTTCTCTTCATATTTCACTGG - Intronic
1181775606 22:25158202-25158224 AGACCCTCTTGATATATCACAGG - Intronic
1184749070 22:46473771-46473793 ACAGCCACTTCAAAGTTCCCTGG - Intronic
949813446 3:8033096-8033118 ACATCGACTTCATATCTCTCGGG + Intergenic
949831606 3:8220944-8220966 ACCCCCACATCTTATCTCACGGG + Intergenic
951487794 3:23233382-23233404 CCACCCACTTCAGATCTCAGGGG - Intronic
952127499 3:30318865-30318887 ACACCCACTTGATAAGTCAGTGG - Intergenic
961879273 3:130049297-130049319 CCACCCACTTCATCCTTCAAAGG - Intergenic
964624697 3:158747971-158747993 GGACCCACTTCATGGTTCACAGG - Intronic
965207331 3:165738660-165738682 ATACCAACATCATTTTTCACAGG + Intergenic
968719512 4:2190263-2190285 ACAGCCAATTCATTTTTGACAGG + Intronic
969169872 4:5352872-5352894 ATACCAACATCATTTTTCACAGG + Intronic
970814499 4:20138126-20138148 AAATCCACTCCATATTTCAATGG + Intergenic
971473182 4:27049232-27049254 ACAACCCATTAATATTTCACTGG + Intergenic
973295054 4:48509403-48509425 CCACACACTTCATTTTTCATAGG + Intronic
975393151 4:73843524-73843546 ACCCACACCTCATGTTTCACTGG + Intronic
975659007 4:76669911-76669933 ACACCCACACCATATCTCATAGG + Intronic
976479966 4:85530560-85530582 ACACTCACATAATAATTCACTGG + Intronic
977082594 4:92551290-92551312 ACACGCATTTCTTATGTCACAGG + Intronic
977196658 4:94070682-94070704 ACACCAACTTCATTTATCAGAGG - Intergenic
977957078 4:103041008-103041030 ACAGGTACTTCATATTTTACTGG + Intronic
979080493 4:116333020-116333042 ACACCCAATTCTTGTTTCTCTGG + Intergenic
979091983 4:116494965-116494987 AAACCCAATACATATTTCTCAGG + Intergenic
980370018 4:131857148-131857170 ACATCCATTTCATTTTGCACTGG + Intergenic
980483713 4:133425319-133425341 ACACCCATTCTGTATTTCACAGG - Intergenic
980986531 4:139700722-139700744 ACATCCACTTTCTATTTGACTGG + Intronic
981653608 4:147087207-147087229 TCACCCAGTTCATACTTCATCGG - Intergenic
985892371 5:2725553-2725575 GCACCCACGTCATTTTCCACAGG - Intergenic
986648259 5:9939492-9939514 TAACCCTCTTCATATCTCACTGG - Intergenic
987449592 5:18065156-18065178 ACACCCATTTGTTATCTCACTGG - Intergenic
989000367 5:36753886-36753908 ACACACACTTCATATTAGAAAGG + Intergenic
989238595 5:39177843-39177865 ATACCCACTTCCTACTTTACTGG + Intronic
989384584 5:40842739-40842761 CCAGCCACCTCTTATTTCACTGG - Intronic
990160344 5:52932102-52932124 AGTCCAACTTCATATTTTACCGG - Exonic
990833160 5:59983359-59983381 ACACTTCCCTCATATTTCACAGG + Intronic
993292266 5:86089015-86089037 AAACCCACTTCTTTTTTCTCAGG - Intergenic
993618258 5:90138091-90138113 AGACCATCTTCTTATTTCACTGG - Intergenic
993641575 5:90412283-90412305 ACAACCACTTCTTGCTTCACGGG + Intergenic
997026222 5:130065176-130065198 ACACTAAGTTCATATTTTACAGG - Intronic
998225723 5:140324881-140324903 ACACCCACATCATATGTCTTTGG + Intergenic
998811791 5:145973946-145973968 ACACACACTTATTATCTCACAGG + Intronic
1001423964 5:171611373-171611395 TCATCCACTTCATCTTTCATTGG - Intergenic
1003488929 6:6604148-6604170 ACCCTCAATTCACATTTCACTGG + Intronic
1003499083 6:6689540-6689562 ACACCCACTCCATTCTACACAGG + Intergenic
1004244457 6:13959799-13959821 ACAAACACTTCAAATTTAACAGG - Intronic
1005188124 6:23185468-23185490 ATACCAACTCCAAATTTCACAGG + Intergenic
1009991497 6:70847878-70847900 ACACACACTTCCTCTTTCAGGGG - Intronic
1013255582 6:108381109-108381131 ACACTCATTTTATATTTCATGGG + Intronic
1015437579 6:133207297-133207319 ACCCATTCTTCATATTTCACAGG + Intergenic
1018363066 6:163092248-163092270 ACCCCCACTGCTTATTTCAGAGG - Intronic
1019643863 7:2118788-2118810 AAAGCCACGTCATATCTCACAGG + Intronic
1021991114 7:26142488-26142510 ACTTCCACTTCATACTTCATTGG - Intergenic
1023635795 7:42208907-42208929 ACACACATTTCAGATTTCAAAGG + Intronic
1023636626 7:42217938-42217960 AGACCTACTTCACACTTCACAGG - Intronic
1023704405 7:42926005-42926027 TCACCCCCTTTATATTTCACAGG - Intronic
1023710876 7:42991383-42991405 ACAGCCTCTTCATAATTCATGGG - Intergenic
1024081634 7:45861472-45861494 ACAGTAACTTCATATTTCATTGG - Intergenic
1026675619 7:72425705-72425727 ACAAACACCTCATACTTCACAGG - Intronic
1028679580 7:93510338-93510360 ACACTGAGTTCATCTTTCACTGG + Intronic
1031811876 7:126380200-126380222 GCATCTACTTCATATTTTACTGG - Intergenic
1038006120 8:23431941-23431963 ACACACACTTCAGAATTTACTGG - Exonic
1040579378 8:48683915-48683937 ACACCCAGTCCATGTTTCTCAGG + Intergenic
1041684049 8:60626109-60626131 AGACCCTATTCCTATTTCACCGG - Intergenic
1042890904 8:73609118-73609140 ATCCCCACTTAGTATTTCACAGG - Intronic
1043809750 8:84722940-84722962 TCACACACTTGAAATTTCACAGG + Intronic
1044891135 8:96836933-96836955 ATAGCCAATCCATATTTCACTGG + Intronic
1045429399 8:102098890-102098912 ACACTGACTTCATCTCTCACTGG + Intronic
1047488864 8:125357727-125357749 CCACACACTTTATTTTTCACTGG - Exonic
1048801264 8:138196131-138196153 ACACCCTCATCATATTTTACTGG - Intronic
1048977148 8:139679424-139679446 ACACCCACTTCTTGTTACAAGGG + Intronic
1049840311 8:144766799-144766821 ACACCCACGTATTATTTCAGGGG + Intergenic
1050777620 9:9286136-9286158 TCTCCCACTTCACATTTCATTGG + Intronic
1051061750 9:13053262-13053284 ACATCCACTCCATATTTCCTTGG - Intergenic
1051487428 9:17624090-17624112 ACAGCCACTGCATTTTTAACGGG - Intronic
1051972644 9:22909451-22909473 TCTCCCACTTTATCTTTCACAGG - Intergenic
1053634408 9:39982797-39982819 ACATCCACTTCATTTTGCACTGG + Intergenic
1053771342 9:41480688-41480710 ACATCCACTTCATTTTGCGCTGG - Intergenic
1054209479 9:62267900-62267922 ACATCCACTTCATTTTGCACTGG - Intergenic
1054315513 9:63581078-63581100 ACATCCACTTCATTTTGCACTGG + Intergenic
1203732703 Un_GL000216v2:105196-105218 AAAGGCACTTCAAATTTCACTGG - Intergenic
1188811570 X:34657978-34658000 AGACTTACTTCATATTTCGCAGG - Intergenic
1189281849 X:39824658-39824680 ACCCCCACTGCATTTTTCTCTGG + Intergenic
1189684069 X:43545543-43545565 AGACCCACTACAGATTTGACTGG + Intergenic
1190147688 X:47911262-47911284 AGACACACTTCATATATGACAGG - Intronic
1194670386 X:96724643-96724665 ACAGCCACTTCATATTTAATGGG + Intronic
1195469824 X:105219358-105219380 ACAGCCACATCTTATTTCTCTGG - Exonic
1197884857 X:131207951-131207973 ACACCAACATCATCTCTCACCGG - Intergenic
1199414528 X:147565932-147565954 CCACCTACTGCATCTTTCACAGG - Intergenic
1202628246 Y:56882474-56882496 AAAGGCACTTCAAATTTCACTGG + Intergenic