ID: 909155000

View in Genome Browser
Species Human (GRCh38)
Location 1:72062816-72062838
Sequence CTTGTCTTGCAAAGGAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909154996_909155000 12 Left 909154996 1:72062781-72062803 CCTGTGAAATATGAAGTGGGTGT 0: 1
1: 0
2: 1
3: 16
4: 185
Right 909155000 1:72062816-72062838 CTTGTCTTGCAAAGGAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909155000 Original CRISPR CTTGTCTTGCAAAGGAAACC AGG Intronic
No off target data available for this crispr