ID: 909156906

View in Genome Browser
Species Human (GRCh38)
Location 1:72089877-72089899
Sequence CACTTCAGGGATTTGTGGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909156906 Original CRISPR CACTTCAGGGATTTGTGGTA CGG Intronic
908092280 1:60698830-60698852 CAGTTCAGGGGTTTGTGGAAAGG - Intergenic
909156906 1:72089877-72089899 CACTTCAGGGATTTGTGGTACGG + Intronic
909968362 1:81947532-81947554 TACTTCATGGAGTTGTGGTAAGG + Intronic
912210855 1:107555448-107555470 TACTTCTGGGATTTGTGGGAAGG - Intergenic
913353752 1:117894442-117894464 CACTGCCTTGATTTGTGGTAAGG - Intronic
914445160 1:147744186-147744208 AACTTCATGGATTTGTGACAAGG - Intergenic
916268091 1:162912013-162912035 CACTTCAGTGTTTTTTGGTAGGG + Intergenic
919359746 1:196577623-196577645 CAATTCCTGGATTTGTGTTAGGG - Intronic
920433740 1:205935309-205935331 AACTTCAGGTATTTTTTGTAAGG + Intronic
922437240 1:225618594-225618616 CACTTGATAGATTTGTGGAATGG - Intronic
1063521031 10:6741055-6741077 CACTTTAGGGATTGGTTGAAAGG + Intergenic
1063816410 10:9779213-9779235 CACTGCAGTGAATTGTGGGATGG - Intergenic
1065769134 10:29060696-29060718 CATTTGAGGGATTCGTGCTAGGG + Intergenic
1068335997 10:55632897-55632919 GACTTCACGGATTTGTTGTTAGG - Intergenic
1068986665 10:63113977-63113999 CAGTTCAGGGTTTTGGGGAAGGG - Intergenic
1069041274 10:63698058-63698080 TACTTCTGGGATTTCTGGGAAGG - Intergenic
1069647302 10:70010286-70010308 AACTTCCTGGATTTGTGGTTTGG - Intergenic
1069924364 10:71838018-71838040 AGCTTCAGGGATTTCTGGGAGGG + Intronic
1073632987 10:105167333-105167355 CCAGTCAGGCATTTGTGGTAAGG + Exonic
1074095644 10:110309676-110309698 CACTTCCCTGATTTCTGGTAAGG - Intergenic
1074342227 10:112643489-112643511 CACTTCAGGGCTTTGTACAATGG - Intronic
1075903852 10:126064100-126064122 CACTTCAGGGGCTTGTTGGAGGG + Intronic
1079768261 11:24422565-24422587 CAGGTCTGGTATTTGTGGTATGG + Intergenic
1081381870 11:42426376-42426398 AACTTCAGGGATTTTTCCTATGG + Intergenic
1085618074 11:78017043-78017065 CACTTCAGGGATGTGCTGTGTGG + Exonic
1085713739 11:78853721-78853743 CACCTCACTGATTTGTGGTTTGG - Intronic
1086381687 11:86261509-86261531 CAGTTCTGGGATTTGGGGGATGG + Intronic
1087215922 11:95494582-95494604 AACTTCTTGGATTTGTGGTTTGG + Intergenic
1093851406 12:24043946-24043968 CACTTCAGAGATTTGGGGTAAGG + Intergenic
1093861795 12:24175030-24175052 CACTTCTGAGCTTTGAGGTAAGG - Intergenic
1096601032 12:52729683-52729705 AACTTTGGGGGTTTGTGGTAGGG - Intergenic
1099389543 12:82062471-82062493 AAGTTTAGGGATTTGAGGTATGG + Intergenic
1100418393 12:94403077-94403099 TACTGCAGGGTTTTGGGGTAGGG + Intronic
1100793912 12:98159799-98159821 GAGTTCTGGGATTTGTGGTTTGG + Intergenic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1102258504 12:111429692-111429714 CACCTCCGGGGTTTGTGATAAGG - Intronic
1102471589 12:113162668-113162690 CACTTCAGGGAATGGAGGTAGGG + Intronic
1103029732 12:117603205-117603227 CACTTTAGTAATTTGTGCTAAGG - Intronic
1104294194 12:127496651-127496673 CCCTTTGGGGAGTTGTGGTAAGG - Intergenic
1105820186 13:24073792-24073814 CACCTCAGGGAGATGTGGGAGGG + Intronic
1106119073 13:26843238-26843260 CTCTTCAGGGCTTTGTCTTAAGG + Intergenic
1107672561 13:42761154-42761176 CAGTTCAGGAATTTTTGGCAAGG + Intergenic
1112488762 13:99843209-99843231 CACTTCCAGGATTTGTCCTAAGG + Intronic
1112707319 13:102085363-102085385 CAGTTGAGGGATTTGGGGTGAGG - Intronic
1112806098 13:103165380-103165402 CACTTTTGGCATTTGTGATAAGG - Intergenic
1116379817 14:44251477-44251499 CACTTCAGTGCTTAGTGGTCTGG + Intergenic
1120186743 14:81401430-81401452 CATTTTATGGATTTATGGTATGG - Intronic
1122983274 14:105201084-105201106 CCGGTCAGGGATTTGTGGGAGGG + Intergenic
1202870597 14_GL000225v1_random:159572-159594 CACCTCAGTGATTTGTGAAAAGG - Intergenic
1126323355 15:47448373-47448395 GGCTTCAGTGATTTGTGGCACGG + Intronic
1129071190 15:72952898-72952920 CACTCCAGGGAGGTGTGGTGTGG + Intergenic
1130307210 15:82721328-82721350 CACTTCATGGACGTGTAGTAAGG + Intergenic
1131426678 15:92351084-92351106 AATTTCAGAGATTTGTGGTATGG + Intergenic
1135544588 16:23357113-23357135 CACTTCAGGCCTCTGTGGAAAGG + Intronic
1138782159 16:59801895-59801917 CACTTCAGGGGCTTGCAGTATGG + Intergenic
1139121975 16:64031422-64031444 AACTTCTTGGATTTGTGGTATGG + Intergenic
1140714587 16:77710762-77710784 CACCTCATAGATTTGTTGTAAGG + Intergenic
1146017071 17:29242305-29242327 TACTTCACGGCATTGTGGTAAGG + Intergenic
1147755222 17:42762946-42762968 CAATCCAGGGATCTGTGGTGGGG - Exonic
1148823531 17:50375621-50375643 AACTTCAGGGATCTTTGGAAAGG - Exonic
1149006011 17:51806087-51806109 ACCTTCAGAGCTTTGTGGTATGG + Intronic
1149441001 17:56673854-56673876 CACTTCCTGTGTTTGTGGTAAGG + Intergenic
1151916664 17:77123376-77123398 CACTTCAGGGGGTTCTGGAAGGG - Intronic
1153481315 18:5549781-5549803 CACCTGTGGGATTTTTGGTATGG - Intronic
1155936109 18:31755992-31756014 CACATCAGGCAGTTGTGGGATGG - Intergenic
1155995986 18:32332064-32332086 CACTTGGGGCATTTGTGGTTGGG + Intronic
1156956476 18:42971101-42971123 TACTTCCTGGATTTGTTGTAAGG + Intronic
1157304671 18:46508231-46508253 GACTGCAGGGCTTTGTGTTATGG + Intronic
1158501988 18:58010719-58010741 TCCTTCAGGGGTTTGGGGTAGGG - Intergenic
1159269129 18:66126304-66126326 CTCCTCAGGGATTTGTGGAATGG - Intergenic
928223937 2:29431439-29431461 CACTTCAGGGATTTTTATTTGGG - Intronic
928648192 2:33377208-33377230 CAATCCAGGGATTTGGGGTTTGG - Intronic
935682516 2:105650278-105650300 CACTTCAGAGAGTTGTTTTAAGG - Intergenic
937892255 2:126947747-126947769 CACTTCCTGGATTTGTGATCAGG + Intergenic
939540804 2:143491593-143491615 CACCTCAGGGATTTATGATAAGG + Intronic
940221518 2:151356919-151356941 CACTTCAAGAATTTGTGGCCTGG + Intergenic
940875243 2:158891737-158891759 TACTTCATGGAATTGTGGTGAGG + Intergenic
943837898 2:192538371-192538393 CCCTTTAGGCATTTGAGGTATGG + Intergenic
946843709 2:223840774-223840796 CTCTTCGGTGATTTGGGGTATGG - Intergenic
947225286 2:227834028-227834050 CAATTCAGGGAATTGTAATATGG - Intergenic
1173227090 20:41168361-41168383 CACTTCACAGATGAGTGGTAGGG + Intronic
1173563025 20:44019871-44019893 CACCCCAGGGAGTTGTGGAAAGG + Intronic
1175332907 20:58177121-58177143 TTCATCAGGGTTTTGTGGTATGG - Intergenic
1175334665 20:58187418-58187440 CACTGCAAGGATTCCTGGTAGGG + Intergenic
1176185785 20:63778133-63778155 CAGTTCAGAGGTTTTTGGTATGG - Intronic
1179129814 21:38624738-38624760 CACTTGAGGCAAATGTGGTAGGG + Intronic
1182162504 22:28137172-28137194 CACATCAGGGAATTGTGCCATGG - Intronic
1182752987 22:32656851-32656873 CACTGCAGGGCATTGTGGGAGGG + Intronic
1183090790 22:35520441-35520463 TGCTTCAGGGATTTGCTGTATGG + Intergenic
1184851280 22:47122617-47122639 GACTTCAGGGATCTTTGATAAGG + Intronic
952945421 3:38475544-38475566 CACTTCAGGGAGTTGCAGAAAGG + Intronic
953184755 3:40627665-40627687 GACTTTAGTGACTTGTGGTAGGG - Intergenic
955820373 3:62890241-62890263 CACTTCACTGGGTTGTGGTAAGG - Intergenic
958745418 3:98128232-98128254 CACTTTAGGTATTTGTTATAGGG + Intergenic
967268814 3:187716093-187716115 CACTTCAGTGAGTTGTCGTGAGG + Intronic
971254372 4:25000868-25000890 AACTTCAGGGATTCTTGGGATGG + Exonic
973640146 4:52894429-52894451 CATTTCTGGAATTTGTGGTTTGG - Intronic
975642330 4:76512681-76512703 GACCTAAGGGACTTGTGGTAGGG + Intronic
978218277 4:106235263-106235285 CTCTTCTGGGAGTTGAGGTAAGG - Exonic
980504756 4:133702845-133702867 AACTTCAGTGACCTGTGGTAAGG + Intergenic
982430771 4:155319564-155319586 CACTCCAGGGTTCTGTGTTACGG - Intergenic
984531296 4:180919843-180919865 TACTTCAAGGATTTCTGGGAAGG + Intergenic
987592048 5:19942516-19942538 CCCTCCAGGGATTTGTAGAATGG - Intronic
989007623 5:36832916-36832938 TACTTCTGGGAATGGTGGTAGGG - Intergenic
991347498 5:65685137-65685159 CTCATCTGAGATTTGTGGTACGG + Intronic
993463075 5:88209594-88209616 CATTTTAGGCATTTGTGGTGTGG - Intronic
993631597 5:90292898-90292920 CAATTCAGGAATTTGTAGAAGGG - Intergenic
993954371 5:94214482-94214504 CACTTCAGGTATTGGGGGAAGGG - Intronic
999232699 5:150070901-150070923 CACTTCAGGGATTTGTAGCAGGG - Intronic
1000133711 5:158324099-158324121 ACGTTCAGGGATATGTGGTAGGG - Intergenic
1001219334 5:169885868-169885890 CACCTCATGGATTTTTTGTAAGG - Intronic
1002392701 5:178928282-178928304 GACTTTAGGGATTAGTGGAAAGG - Intronic
1011015352 6:82748528-82748550 TACTCCAGGGATTTGGGGTGAGG - Intergenic
1018213285 6:161502955-161502977 TACTTCATGCATTTGTGGCAAGG + Intronic
1020888735 7:13852351-13852373 CACTACTGTGATTTGTGCTATGG - Intergenic
1021694002 7:23258810-23258832 CTCTCCAGGGATGTGTGGTTTGG - Intronic
1024916748 7:54509813-54509835 GACTTTGGGGATTTGTGGTGTGG - Intergenic
1027540277 7:79456150-79456172 CACTCCTGGGATTTGGGGGATGG - Intergenic
1034131577 7:148723058-148723080 CACCTCATGGGTTTGTGGTGAGG - Intronic
1036749941 8:11437167-11437189 CACTGCAGGGCTTTGAGGTCGGG + Intronic
1038446504 8:27608131-27608153 CACTTCAGGGATTGCTGGCCTGG - Intronic
1039468083 8:37797633-37797655 CACTTCAGAGATTTCTGGACAGG + Intronic
1039982136 8:42416726-42416748 CACTTCAGGGATGAGAGGGAGGG - Exonic
1040322624 8:46326345-46326367 CACACCAGGGATTTCTGGGAAGG + Intergenic
1041047532 8:53901488-53901510 CACTTCAGGGCTTAGAAGTAAGG + Intronic
1046886136 8:119369329-119369351 CAATACAGGAATTTGTGGGAGGG - Intergenic
1047027213 8:120836938-120836960 CACTTCAGGGTTTTGTGGGTAGG + Intergenic
1048472909 8:134719339-134719361 CACATCAGGGGTTGGTGGAAGGG + Intergenic
1050348433 9:4716475-4716497 CAAATAAGGGATTTGTGGCATGG + Intronic
1050403660 9:5284366-5284388 CACTTCCTGGATTTGTGGTTTGG - Intergenic
1053555930 9:39136997-39137019 AACTTCCTGGATTTGTGGTTTGG + Intronic
1053820051 9:41957237-41957259 AACTTCCTGGATTTGTGGTTTGG + Intronic
1054110322 9:61100922-61100944 AACTTCCTGGATTTGTGGTTTGG + Intergenic
1054610535 9:67230203-67230225 AACTTCCTGGATTTGTGGTTTGG - Intergenic
1056706247 9:88954749-88954771 CACTTCAGGGATGTTTGGGAAGG + Intergenic
1203733858 Un_GL000216v2:117017-117039 CACCTCAGTGATTTGTGAAAAGG + Intergenic
1186579643 X:10803760-10803782 AACTTCCTGGATTTGTGGTTTGG + Intronic
1188805719 X:34586855-34586877 GGCTTCAGGTATTTGTGTTATGG + Intergenic
1190429853 X:50368595-50368617 CTCTTCAGGGAGTTTTGGAATGG - Exonic
1191661575 X:63657061-63657083 CACTGCTGGGAGATGTGGTATGG + Intronic
1195954566 X:110316349-110316371 CAATTCAGGTATTTATGATATGG + Intronic
1198196898 X:134372721-134372743 TACCTCACGGGTTTGTGGTAAGG - Intergenic
1202627152 Y:56871393-56871415 CACCTCAGTGATTTGTGAAAAGG - Intergenic