ID: 909160068

View in Genome Browser
Species Human (GRCh38)
Location 1:72135474-72135496
Sequence GACTGAAGGACAGTGATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909160063_909160068 30 Left 909160063 1:72135421-72135443 CCAAAAAAAAAAAAAAAAAGAAA 0: 508
1: 14567
2: 18093
3: 33549
4: 72299
Right 909160068 1:72135474-72135496 GACTGAAGGACAGTGATCTCTGG 0: 1
1: 0
2: 1
3: 19
4: 180
909160066_909160068 -3 Left 909160066 1:72135454-72135476 CCAGACACATGAGATTTAGGGAC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 909160068 1:72135474-72135496 GACTGAAGGACAGTGATCTCTGG 0: 1
1: 0
2: 1
3: 19
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909160068 Original CRISPR GACTGAAGGACAGTGATCTC TGG Intronic
906108406 1:43308054-43308076 GTCTGATGGACAGGGAGCTCTGG + Intronic
908167364 1:61471647-61471669 GATTGGAGGAGAGTGATGTCAGG + Intergenic
909160068 1:72135474-72135496 GACTGAAGGACAGTGATCTCTGG + Intronic
912797769 1:112703181-112703203 GCCCGAAGGACAGTGGTTTCAGG - Intronic
915896380 1:159814285-159814307 GAGTGAAGGTGAGTGATCTCAGG + Exonic
916454641 1:164958487-164958509 GACTGAAGCTCAGAGATATCTGG + Intergenic
916618408 1:166469439-166469461 GACTGAAGAAAAGTAATCTGTGG + Intergenic
919854014 1:201693593-201693615 GCTTGAAGGGGAGTGATCTCTGG + Intronic
921119101 1:212121143-212121165 GACTGCAGGACAATTATCTCTGG - Intergenic
921655867 1:217736615-217736637 GACTGAAGCATAGTGATCCTGGG + Intronic
922321554 1:224492984-224493006 GAATGGAGGACAGTGATCCATGG + Intronic
924018000 1:239748880-239748902 TACTGAAGGAAAATGATTTCTGG + Intronic
924580887 1:245323602-245323624 GACTGAAGGGCACTGTTCTGAGG - Intronic
924775665 1:247113170-247113192 GCCTGATGAACAGTGATCTCTGG + Intergenic
1062941309 10:1423265-1423287 AAAAGAAGGACAGTGATTTCAGG - Intronic
1063598159 10:7456245-7456267 GAGTGAAGGACCATGATTTCAGG - Intergenic
1063611147 10:7563035-7563057 GCATGAAGGACAGTGATGTGGGG - Exonic
1066512157 10:36112678-36112700 GGCAGAAGGAAAATGATCTCAGG - Intergenic
1067195494 10:44114435-44114457 GATTCAAGGACAGTGATCATGGG - Intergenic
1067711606 10:48655422-48655444 AGCTGGAGGACAGTGACCTCAGG + Intronic
1068077916 10:52280662-52280684 GCTAGCAGGACAGTGATCTCTGG + Intronic
1071341401 10:84652134-84652156 GAATGAGGGACAGTGCTATCCGG - Intergenic
1072792274 10:98327009-98327031 GACCGCTGGACAGTGGTCTCTGG + Intergenic
1072824427 10:98591867-98591889 AACTGAAGTATAGTGATCACAGG - Intronic
1073235396 10:102010742-102010764 GACTGAAAGGCAGAGATATCTGG + Intronic
1076190940 10:128483027-128483049 GCCTGATGGGCAGTGATCCCCGG + Intergenic
1076354716 10:129843246-129843268 TACTGAAGGGCAGTGATAACTGG - Intronic
1080974314 11:37318854-37318876 GTCTGACAGACACTGATCTCTGG + Intergenic
1084984746 11:72858926-72858948 TCATGAAGGACAGTGATCCCTGG + Intronic
1085103162 11:73818825-73818847 CATTGAAGGACAGTTGTCTCTGG + Intronic
1086994047 11:93336474-93336496 GACTGAAAGAGAGTGACCTGGGG - Intronic
1090685746 11:129116770-129116792 GACCCAAGGACAGTGTTGTCAGG - Intronic
1093105380 12:15080106-15080128 GACAGAATGAAAGTGTTCTCTGG - Intergenic
1097602420 12:61710015-61710037 GACAGAAGGACAGTGCACTTGGG + Exonic
1097855945 12:64462223-64462245 GGCTACTGGACAGTGATCTCTGG - Intronic
1098251252 12:68571754-68571776 GACTGCAGCACTGTGAACTCTGG + Intergenic
1101542215 12:105675607-105675629 GAGTGAGGGAGAGTGAACTCAGG + Intergenic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1103963634 12:124624617-124624639 GACAGAAGGAAAGAGAGCTCTGG + Intergenic
1109094739 13:58098317-58098339 TACTGAAGGACAGTAATCCCTGG - Intergenic
1111232988 13:85368849-85368871 GACTGTATGACAGAGAACTCTGG + Intergenic
1111600023 13:90460996-90461018 GACTGAGGGACAGTTTCCTCAGG + Intergenic
1113965549 13:114151230-114151252 GAGTGAATGACAGAGACCTCAGG - Intergenic
1115162864 14:30415288-30415310 GACTGAAGGTCAGAAAACTCAGG - Intergenic
1115359874 14:32488727-32488749 GAGTGAAGGACCGTGCTATCTGG - Intronic
1118695868 14:68384634-68384656 GACTGAAGGAAAGTTGTCTTGGG + Intronic
1121923763 14:97908583-97908605 GACTAGAGGACAGTGTTCTGGGG - Intergenic
1122100373 14:99404210-99404232 GACTGAAGGTAAGTCATTTCAGG - Exonic
1122140383 14:99659858-99659880 GACTCAGGGTCAGGGATCTCCGG - Intronic
1125789988 15:42357903-42357925 GAATAGAGGACAGTGGTCTCTGG - Intergenic
1126999521 15:54485719-54485741 GACTGAAGCAAAGTGAGTTCAGG - Intronic
1130070628 15:80644157-80644179 GACTGATGGGCCGTGTTCTCAGG - Intergenic
1130990229 15:88871635-88871657 GACTGCAGGACAGGGACCTGGGG + Intronic
1134400911 16:13908792-13908814 CAATGAAGGACAGGGGTCTCAGG + Intergenic
1134872042 16:17660970-17660992 GTCTGAAGAACAGAGAGCTCAGG + Intergenic
1135508130 16:23057366-23057388 GGCTGAAGGAGAATGATCTCAGG + Intergenic
1142366351 16:89652015-89652037 GACTGAAGGAAACTCATTTCAGG + Intronic
1144808784 17:17985329-17985351 GACTGATGGCCAGTGCTCCCTGG + Intronic
1147017810 17:37506505-37506527 CACTGCAGGACAATGGTCTCTGG - Intronic
1147192659 17:38747066-38747088 CACTGAGGGACAAAGATCTCGGG + Intronic
1147213111 17:38883587-38883609 GCCTGAAGGACAGGGATTTGGGG - Intronic
1147486072 17:40815826-40815848 AACTGAAACACAGTGATCCCTGG - Intergenic
1150416431 17:64992532-64992554 GACTCATGGAGAGTGATGTCTGG + Intergenic
1150849782 17:68693665-68693687 CACTGAAGGTCAGTGACCTGAGG - Intergenic
1152060685 17:78072282-78072304 GACTGGAACACAGTAATCTCAGG - Intronic
1154037601 18:10819797-10819819 GACTTAAGGAAAATGATTTCAGG - Intronic
1154994762 18:21629530-21629552 GACAGAAGGAAAGTGATGTATGG + Exonic
1157008680 18:43619946-43619968 GAGGGAAGGACTGTGATATCTGG - Intergenic
1159626964 18:70706565-70706587 GACTGAAGGGCAGAGACCTAGGG + Intergenic
1160206516 18:76838163-76838185 GAGTGAAGTACATTGATCTTGGG + Intronic
1163639373 19:18452680-18452702 GGCTGCAGGACAGTGAGCCCAGG + Intronic
1168556731 19:57349284-57349306 GGTTGAAGGAAAGTGATCCCAGG - Intergenic
925955726 2:8961979-8962001 GACTGCAGGACAGTCCCCTCTGG - Intronic
926081328 2:9988735-9988757 AACTAAAGAACAGTGATCCCTGG - Intronic
926118386 2:10227537-10227559 GCCTGCAGGACAGAGACCTCTGG + Intergenic
926707397 2:15846395-15846417 AACTGCAGGACAGTGAGGTCAGG + Intergenic
927384637 2:22518977-22518999 GATTGAATTACAGTGTTCTCTGG + Intergenic
931111298 2:59114186-59114208 GACTGAAGTCCAGTCTTCTCTGG + Intergenic
931193822 2:60030890-60030912 GCCTGAAGGCCAGTGATGCCTGG + Intergenic
931612342 2:64115552-64115574 GACTGAAGGCCAAAGAACTCTGG + Intronic
931642180 2:64391771-64391793 GGCTGAAGGATAATGATCTCAGG - Intergenic
936153358 2:110033477-110033499 GACAGATGGGCAGTGCTCTCTGG + Intergenic
936191323 2:110337938-110337960 GACAGATGGGCAGTGCTCTCTGG - Intergenic
936348338 2:111692073-111692095 TGCTTAAGGACAGTGACCTCAGG - Intergenic
940438444 2:153683952-153683974 TGCTGAAGGACAGTGATAGCTGG - Intergenic
942532535 2:176927341-176927363 AACAAAAGGACAGTGATATCAGG + Intergenic
943391852 2:187279308-187279330 GACTGTAGGAGAGTGTGCTCTGG + Intergenic
945356487 2:208845520-208845542 CAATGAAGGACAGTGATTTCTGG + Intronic
945748068 2:213743398-213743420 GACAGAAGGAAGTTGATCTCAGG - Intronic
945985317 2:216348962-216348984 GACTGAAGGACTGTGATATATGG - Intronic
949056354 2:241930022-241930044 TAATGAAGGACACTGATCCCTGG + Intergenic
1169069429 20:2714051-2714073 GAGTGAAGGTAAGTGATCTTGGG + Intronic
1171251540 20:23652957-23652979 CTCTGAAGGACACAGATCTCAGG - Intergenic
1173458893 20:43225904-43225926 GAATCAAGGATAGTGATTTCAGG - Intergenic
1174555957 20:51395619-51395641 GACTGATGGAGAATGATCTCAGG + Intronic
1175311210 20:58012740-58012762 GACTGCATGACAGTGAGCTTGGG - Intergenic
1177305098 21:19305312-19305334 GAATCTAGGACAGTTATCTCCGG - Intergenic
1181485086 22:23225500-23225522 GACTGAAGGAGACTGAGCTTGGG - Intronic
1182737834 22:32543669-32543691 GACTGGAGCAAAGTAATCTCTGG - Intronic
1182832011 22:33311962-33311984 GACGGAAGGACAGAGAGCTCCGG - Intronic
1182990606 22:34763863-34763885 GAATGAACCACAGTGATATCTGG - Intergenic
1183754846 22:39751221-39751243 GTCAGAAGGACAGTGAACTAAGG + Intronic
1184591802 22:45489578-45489600 AACTGAAGGAAAGAGATGTCTGG - Intergenic
1184918277 22:47588279-47588301 GACGGCAGGACAGAGATTTCAGG - Intergenic
1185259128 22:49852012-49852034 GAGTGGAGGCCAGTGTTCTCAGG - Intergenic
953016697 3:39083636-39083658 GACTGCAAGACAGTGACCCCAGG + Intronic
954832102 3:53430181-53430203 GACTGAAGGGCAATGAGGTCTGG - Intergenic
957682160 3:83450764-83450786 GACTACAAGCCAGTGATCTCTGG + Intergenic
959925671 3:111919086-111919108 AAGTGAAGAACAGAGATCTCAGG + Exonic
959934645 3:112016434-112016456 GACTGAGTGACAGTAAACTCTGG + Intergenic
960431885 3:117579590-117579612 GACTGTATGGCAGTGATATCAGG - Intergenic
964692058 3:159461073-159461095 GACTCAGAGACACTGATCTCTGG + Intronic
968794999 4:2697527-2697549 GACAGTAGGACAGTGGTCTTGGG + Intronic
968861096 4:3170753-3170775 CAATGAAGGACAGTGATCCCTGG - Intronic
969315936 4:6381300-6381322 GGCTGCAGGGCAGAGATCTCGGG + Intronic
969471124 4:7389894-7389916 GGCTGAAGGACAGTGAGCAGGGG + Intronic
970865988 4:20759536-20759558 GAATGATGGACATTGATCTTGGG + Intronic
972288737 4:37671453-37671475 GACTCAATGAAAGTGACCTCTGG + Intronic
973734627 4:53858768-53858790 GAGAGAAGGAAAGTGATCCCAGG - Intronic
974384637 4:61189202-61189224 GGCTGCAGCAAAGTGATCTCTGG + Intergenic
975728590 4:77316369-77316391 CAGTGAAGGCCAGTGATCCCAGG - Intronic
975734749 4:77370424-77370446 GTCTGAAGGCCAGTGATCTCAGG - Intronic
977205685 4:94162610-94162632 TACTGAAGGACAGTGCCCTGAGG - Intergenic
977485904 4:97645978-97646000 AACTGAGTGAGAGTGATCTCTGG - Intronic
977984275 4:103363512-103363534 GCCTGAAGATCAGTGATCCCAGG + Intergenic
978090231 4:104706789-104706811 GAGTGAGGGACAGTGCTATCTGG + Intergenic
979991153 4:127377239-127377261 GACTGAAGGACAGGCCTCTTTGG + Intergenic
983840523 4:172452135-172452157 GACTCATGGACAGTTATATCAGG - Intronic
985827581 5:2204577-2204599 GGCTGATGGACAGTGACCTCAGG + Intergenic
986265740 5:6188954-6188976 GATTGGAGGACCGTGATATCAGG + Intergenic
991541247 5:67731428-67731450 TAATGAAGGACAGTGACCTCTGG - Intergenic
992520039 5:77541089-77541111 GGCAGAAGGAAAGTAATCTCAGG + Intronic
992687116 5:79209803-79209825 AACTGAAGGACAATGATCTGGGG - Intronic
994143970 5:96372279-96372301 GACTGAAGAACAGAGTTCTCAGG - Intergenic
996837306 5:127807703-127807725 GAGTGAAGCACAGAGCTCTCTGG - Intergenic
997713935 5:136028667-136028689 GACTGAGGGACAGCTGTCTCGGG - Intergenic
998381590 5:141729773-141729795 GCCTGGAGGACAGGGTTCTCTGG + Intergenic
1003128796 6:3377657-3377679 GGCTGCAGATCAGTGATCTCAGG + Intronic
1004925236 6:20410091-20410113 GAATGATGGGCAGTGAACTCAGG + Intronic
1006238835 6:32660117-32660139 CACTGTAGGACTTTGATCTCAGG + Exonic
1006335683 6:33419264-33419286 AACTCAAAGACAGAGATCTCAGG - Intergenic
1007595619 6:43049561-43049583 GACTCAATGACAGTGCCCTCAGG - Exonic
1008234766 6:49030907-49030929 AACTGAAGGGCAGTGAGTTCTGG - Intergenic
1008666806 6:53724705-53724727 GTAAGAAGGACAGTGATCTTAGG - Intergenic
1012492408 6:99796928-99796950 GAAAGAAGGACAGAGCTCTCTGG + Intergenic
1016672778 6:146728229-146728251 GACTGACGAACAGAGATTTCAGG - Intronic
1016979285 6:149839379-149839401 GCCTGAAGGAGAGTCAGCTCCGG + Intronic
1019061645 6:169261718-169261740 CACTGAAGGCCACTGATCACAGG - Intergenic
1020087214 7:5316980-5317002 GACTGAAAGACACTGAGCGCAGG + Intronic
1021398768 7:20184235-20184257 GACTGAATAAAAGTGGTCTCGGG - Intronic
1021710924 7:23414880-23414902 GACTGATGGACAGGGACCTGCGG - Intronic
1025207087 7:57000178-57000200 GACTGAAGGACACTGAGCGCAGG - Intergenic
1025664850 7:63576712-63576734 GACTGAAGGACACTGAGCGTAGG + Intergenic
1026655155 7:72250410-72250432 TACTGAATGAGAGTGATGTCAGG + Intronic
1026678213 7:72446076-72446098 GCCTGAGTGACAGTCATCTCTGG - Intronic
1027416287 7:77978193-77978215 AAATGAAGGATAGTGATTTCTGG - Intergenic
1028247737 7:88502307-88502329 GACTCAAAGACACTGATATCAGG - Intergenic
1028267273 7:88741761-88741783 GACTGAAGGATAGTTATCAGAGG - Intergenic
1033866395 7:145695600-145695622 AACTGGGGAACAGTGATCTCTGG - Intergenic
1035261844 7:157666916-157666938 GCCTGTGGGACACTGATCTCTGG + Intronic
1035261852 7:157666976-157666998 GCCTGTGGGACACTGATCTCTGG + Intronic
1035261867 7:157667096-157667118 GCCTGTGGGACACTGATCTCTGG + Intronic
1035261875 7:157667156-157667178 GCCTGTGGGACACTGATCTCTGG + Intronic
1035261881 7:157667216-157667238 GCCTGTGGGACACTGATCTCTGG + Intronic
1036822500 8:11951939-11951961 GGCTGAAGCAGAGGGATCTCTGG - Intergenic
1037993821 8:23338959-23338981 GCCTGAAGGGCAGTGGACTCAGG - Intronic
1038306200 8:26405084-26405106 GAATGAAGCAAAGTTATCTCTGG - Intronic
1039878862 8:41610834-41610856 GCCTGAAGGACAGTTAGTTCTGG + Intronic
1040112290 8:43571886-43571908 GCCTGGAAGACACTGATCTCTGG + Intergenic
1042357938 8:67849888-67849910 GACTGAAGGCCAGATAGCTCAGG + Intergenic
1042378130 8:68079573-68079595 GACTAAAAGAAAGTGATCCCAGG - Intronic
1045477514 8:102565822-102565844 GACTGAAGAACAGTCACCTGAGG - Intergenic
1045555568 8:103211795-103211817 GAGAGAAGGGCAGTGCTCTCAGG - Intronic
1046683692 8:117200621-117200643 AATTGTAGGACAGTGGTCTCTGG - Intergenic
1047300638 8:123610934-123610956 GACAGAAGGAAAGTGAACTCTGG + Intergenic
1049942549 9:561701-561723 GAATGTTGGACAGTGATCTAAGG + Intronic
1052216502 9:25972520-25972542 GGCTGGAGCACAGTGAACTCAGG + Intergenic
1053461361 9:38273785-38273807 GGCAGAAAGACAGTGAGCTCTGG - Intergenic
1053461434 9:38274318-38274340 GGCAGAAAGACAGTGAGCTCTGG + Intergenic
1058254218 9:102740953-102740975 TACTGTAGGACTGTGATCTTTGG - Intergenic
1060283111 9:122227157-122227179 GACTGAAGGACAGGGATGGAAGG + Intronic
1060677434 9:125528249-125528271 GGCTGAGGGATACTGATCTCTGG + Intronic
1061682403 9:132249475-132249497 GGCAGAAGGACGGTGAGCTCTGG + Intergenic
1061906357 9:133701350-133701372 TCCTGAAGGACAGTGATGCCTGG - Intronic
1187285471 X:17899560-17899582 GTCTGAGGGAGAGTGAGCTCAGG - Intergenic
1189061142 X:37754784-37754806 GGTTGAAGGACAGTCATCTTGGG - Intronic
1189225414 X:39409246-39409268 GAATGCAGGAAAGTGATGTCTGG + Intergenic
1190325885 X:49206670-49206692 GCCTGCAGGACAGAGATCTGGGG - Intronic
1193723700 X:85016920-85016942 GACTGGAGGCCAATTATCTCAGG - Intronic
1194268492 X:91781974-91781996 GACTGAAGAACAGGGTTCTCCGG - Intronic
1194801876 X:98283893-98283915 GATTGAAGGAAAGTGATGACAGG + Intergenic
1195129574 X:101839790-101839812 GACAGAAGGACAGGCCTCTCAGG - Intronic
1195176665 X:102320039-102320061 GACAGAAGGACAGGCCTCTCAGG + Intronic
1195182199 X:102367054-102367076 GACAGAAGGACAGGCCTCTCAGG - Intronic
1195202531 X:102564730-102564752 GACAGAAGGACAGGCCTCTCAGG + Intergenic
1195254920 X:103081571-103081593 GACAGAAGGACAGGCCTCTCAGG - Intronic
1196781174 X:119385766-119385788 GACTGAAGTAGAGTGAACACAGG + Intergenic
1197725602 X:129774345-129774367 GAGGGAAAGACAGTGATCTTTGG - Intergenic
1197888047 X:131238561-131238583 AACTGACAGACAGTCATCTCAGG + Intergenic
1199004181 X:142675566-142675588 CCCTGAGGGACAGTGCTCTCTGG - Intergenic
1200585691 Y:5002887-5002909 GACTGAAGAACAGGGTTCTCCGG - Intronic