ID: 909161486

View in Genome Browser
Species Human (GRCh38)
Location 1:72156651-72156673
Sequence GAACTACAGTGTTTCTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909161482_909161486 7 Left 909161482 1:72156621-72156643 CCATAGTCTTTTTTCATTCCTCA 0: 1
1: 0
2: 0
3: 48
4: 493
Right 909161486 1:72156651-72156673 GAACTACAGTGTTTCTGTGATGG 0: 1
1: 0
2: 0
3: 16
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909161486 Original CRISPR GAACTACAGTGTTTCTGTGA TGG Intronic
906364168 1:45191404-45191426 GAACTACACTGTTTCTCTTCAGG - Intronic
907732112 1:57076692-57076714 GAACTATAGTGTACCTATGACGG + Intronic
907810227 1:57861894-57861916 GAAGTCCAGTATTTCTCTGAAGG + Intronic
908038981 1:60086922-60086944 GTTCTCCAGTGTGTCTGTGAGGG + Intergenic
909125787 1:71667559-71667581 GTAGTACAGAGTTTCTGGGAAGG + Intronic
909161486 1:72156651-72156673 GAACTACAGTGTTTCTGTGATGG + Intronic
910372341 1:86530080-86530102 GAAATACAGTGTTTATGTAACGG - Intergenic
915902497 1:159856539-159856561 GGGCTACAGTGTTTGTGTGGTGG - Exonic
917830579 1:178880394-178880416 GAAATACAGTGTTGCTATTATGG - Intronic
918446650 1:184623607-184623629 GGACTCCAGTGTGCCTGTGAGGG + Exonic
919059089 1:192607980-192608002 GAAGTACAGAGTGTCTGTCATGG + Intergenic
919330997 1:196171543-196171565 GAACTAGAGAGCTTCTGTGCAGG + Intergenic
921438454 1:215155842-215155864 GAAATACAGTGTTTCTTTGTGGG - Intronic
922773835 1:228206055-228206077 GAACAACAGGGGTCCTGTGAAGG + Intronic
923229969 1:231976354-231976376 AAAATGCAGTGCTTCTGTGAAGG + Intronic
923482195 1:234396193-234396215 GAAATACAGTGTTACTGGAATGG - Intronic
923584152 1:235250191-235250213 GAATTTCAGTGTTTATGAGATGG + Intronic
924030092 1:239877799-239877821 GGACGACAATTTTTCTGTGATGG + Intronic
1063798141 10:9536732-9536754 GCAATACAGTCCTTCTGTGATGG + Intergenic
1075987647 10:126801349-126801371 GAAGTACACTGTTTGGGTGATGG - Intergenic
1076312118 10:129515893-129515915 GCAAAACAGTCTTTCTGTGAAGG + Intronic
1076433093 10:130421197-130421219 GAAAAACACTGTGTCTGTGATGG - Intergenic
1077108432 11:851751-851773 TGACCAGAGTGTTTCTGTGACGG + Intronic
1079612590 11:22451742-22451764 CAACTACAGTGATTTTATGAAGG + Intergenic
1082103473 11:48193929-48193951 GGAATACTGTGTTTATGTGAAGG + Intergenic
1086304392 11:85464316-85464338 TAACTCCAGTTCTTCTGTGAGGG - Intronic
1093063697 12:14633526-14633548 GAACTACTGTGTTTCTTTGGAGG - Intronic
1094437614 12:30438472-30438494 GAACACCTGTGTTTCTATGAAGG - Intergenic
1094533174 12:31296803-31296825 GAACTGCAGTGTCACTGTCATGG - Intronic
1095321984 12:40838881-40838903 GAATTACAGTGTTCCTCTGGCGG - Intronic
1099917559 12:88914692-88914714 GAATTACTGTGTTCCTTTGAAGG + Intergenic
1108111191 13:47074720-47074742 GGACTTCAGTGTATTTGTGATGG - Intergenic
1111420482 13:88004767-88004789 GAACTATTGTGTTTCTCTGAAGG + Intergenic
1111434378 13:88187427-88187449 CAACTTGAGTGTGTCTGTGAGGG - Intergenic
1111830823 13:93326825-93326847 TAAATACTGTGCTTCTGTGAAGG + Intronic
1114152509 14:20060143-20060165 GATCTACGGTGCTACTGTGATGG + Exonic
1118026993 14:61779625-61779647 TAACTACAGTTTTTTTTTGATGG + Intronic
1123480642 15:20628505-20628527 GAACTGCAGTTTGCCTGTGAGGG - Intergenic
1123789615 15:23707734-23707756 GAACTGAAGTGTGCCTGTGATGG - Intergenic
1125186833 15:36940515-36940537 GAACTCCAGTGTTTCTCTTGTGG + Intronic
1125398270 15:39273009-39273031 GAACTTCAGTGGTCCTGAGAAGG - Intergenic
1126565491 15:50094040-50094062 AAACTAAAGTATGTCTGTGAGGG + Intronic
1126887552 15:53166873-53166895 GAGTTACTGAGTTTCTGTGAAGG + Intergenic
1127962520 15:63900308-63900330 GAACTACAACGTCTCTATGAAGG + Intergenic
1134385958 16:13772643-13772665 GAAAGACAGTGTTTCTGAGAAGG - Intergenic
1134611478 16:15612470-15612492 GAATTAAACTGTTTCTTTGATGG + Intronic
1137418773 16:48312327-48312349 GAATTACTGTGTTTCTCTGGGGG + Intronic
1137739338 16:50751795-50751817 AAACTCCAGAGTTTCTTTGAAGG + Exonic
1137944431 16:52720130-52720152 GTACTTCACAGTTTCTGTGAAGG + Intergenic
1139103699 16:63801170-63801192 GAACTACAGTGTTACTGGGCTGG - Intergenic
1146709763 17:35030985-35031007 TAACTACAATTTTTCTGGGAAGG + Intronic
1149259828 17:54867084-54867106 GATCTCCAGTGTCTGTGTGAAGG + Intergenic
1151982853 17:77524438-77524460 ACATTAGAGTGTTTCTGTGAGGG - Intergenic
1154024412 18:10693842-10693864 GAAATTAAGAGTTTCTGTGAAGG + Intronic
1155258268 18:24016983-24017005 GAACTATAGTGTTTGTGTCCTGG - Intronic
1155529686 18:26754279-26754301 AAGCTACAGTGTTGGTGTGATGG - Intergenic
1155573387 18:27219497-27219519 GATCCAGAGTGTGTCTGTGAGGG + Intergenic
1156860990 18:41836112-41836134 GAACACAAGTGTTTCAGTGAGGG - Intergenic
1159972220 18:74668824-74668846 GAACTTAGGTGTTTCTGTGTTGG + Intronic
1160341340 18:78091954-78091976 GGACTTCAGTGTTTCTGGGATGG - Intergenic
1161462437 19:4406329-4406351 GGACAACAGTGGTTCTCTGAGGG - Intronic
1168363055 19:55759276-55759298 GAAATACAGTGTGTCTGTCATGG - Intronic
1168364006 19:55769276-55769298 GAAATACAGTGTGTCTGTCATGG - Intronic
925089965 2:1147274-1147296 GATCCTCAGTGTGTCTGTGAGGG + Intronic
927032066 2:19131301-19131323 GAACTGCAGCATTTCTCTGAAGG - Intergenic
929452204 2:42045667-42045689 AAGCTTCAGTGTTTCTGTTATGG - Intergenic
930379716 2:50612685-50612707 GCACTACAGTGTTTATGCCATGG + Intronic
935703529 2:105836141-105836163 GAATTACTGTGTTTCTTTGGAGG + Intronic
937201411 2:120206589-120206611 GAACTCCAGTGTTCCTGAGTGGG - Intergenic
938992220 2:136641268-136641290 GAACTACACTGGTACTTTGATGG - Intergenic
939786637 2:146521636-146521658 GAATTACACTGTTTCTGTACAGG + Intergenic
942376430 2:175342860-175342882 GAATTACTGTGTTTCTTTGGAGG + Intergenic
943569989 2:189562944-189562966 AAACTACAGTTTTTTTGTTAAGG + Intronic
943970263 2:194395557-194395579 GAAGGTCAGTGTGTCTGTGAGGG + Intergenic
944416955 2:199488584-199488606 CAACAATAGTGTTTCTATGAAGG - Intergenic
945061833 2:205916082-205916104 CAACCACAGTGTGTCTTTGATGG + Intergenic
945266924 2:207899801-207899823 GATCTACAGTGTTTCTTCCATGG - Intronic
945357326 2:208856025-208856047 GAATTGCAGAGTTTCTGTGTGGG + Intergenic
945804189 2:214470124-214470146 GAACTACAGTTATTCTGTAATGG - Intronic
945833774 2:214814265-214814287 GGACTACAGTGTTACAGTGGGGG - Intergenic
946527519 2:220537266-220537288 AATCCACAGTGTGTCTGTGAGGG - Intergenic
1169536008 20:6541222-6541244 GAACTACAGTGAAAATGTGATGG + Intergenic
1169774723 20:9240078-9240100 GTACCTCAGTGTGTCTGTGAGGG - Intronic
1174956608 20:55105259-55105281 GAACTATTGTGTTCCTTTGAAGG + Intergenic
1175343802 20:58254723-58254745 AAGCTACAGTTTTACTGTGAAGG + Intergenic
1177309245 21:19367033-19367055 GAACTACAGTCTTTCTGGAAAGG + Intergenic
1178330963 21:31690829-31690851 GAACTGGAGAGTTTTTGTGAAGG - Exonic
1181364190 22:22362111-22362133 GATCCTCAGTGTGTCTGTGAGGG - Intergenic
1183194736 22:36345581-36345603 GAAGCACAGTGTGTCTGTGGGGG - Intronic
1183941731 22:41299564-41299586 GAGCTACAGGGTTTTTGAGAGGG + Intergenic
950906188 3:16540801-16540823 CAACTAAAGTGTGTCTGTGGCGG - Intergenic
951980347 3:28559359-28559381 GAACAATAGTGTTTCTTTCATGG - Intergenic
952068387 3:29601274-29601296 GAATTTCATAGTTTCTGTGATGG - Intronic
952414346 3:33076854-33076876 GAAATACAGTTTTTATGTGAAGG - Intronic
952566944 3:34669922-34669944 GAACCACAGTGTTACTGGGCTGG + Intergenic
955037231 3:55280758-55280780 GAACCCCATTATTTCTGTGATGG - Intergenic
957326723 3:78705548-78705570 GAACATCAAGGTTTCTGTGATGG + Intronic
959207487 3:103329136-103329158 AAAATACAGTGTTTGTCTGAAGG - Intergenic
962897190 3:139726371-139726393 AAACTACAGTGTTTCAGAGATGG - Intergenic
966806932 3:183815160-183815182 CAACTCCAGTGTTGCTCTGAGGG - Intergenic
970005284 4:11405124-11405146 GAAGGACAGAATTTCTGTGAAGG + Intronic
970071087 4:12161284-12161306 GAACCACAGTGTTACTGGGCTGG - Intergenic
970232926 4:13929137-13929159 GAACTTCACTGGCTCTGTGAAGG + Intergenic
970816710 4:20164993-20165015 GAACTAAATTGTTTGTGTCATGG + Intergenic
971100713 4:23463971-23463993 GATCCTCAGTGTGTCTGTGAGGG - Intergenic
971501520 4:27323539-27323561 CACCTACAGGGTATCTGTGAGGG - Intergenic
971662888 4:29442865-29442887 CAGCTTGAGTGTTTCTGTGAAGG + Intergenic
971674695 4:29611433-29611455 GATCCTCAGTGTGTCTGTGAAGG + Intergenic
971740339 4:30511626-30511648 AAGCTAGAATGTTTCTGTGATGG - Intergenic
974778665 4:66522348-66522370 GAAGTACTTTGTCTCTGTGATGG - Intergenic
976311456 4:83617202-83617224 TAACTACAGTCTTCCTTTGAAGG - Intergenic
977308108 4:95350842-95350864 CAACTTAGGTGTTTCTGTGAAGG + Intronic
978730598 4:112022069-112022091 AAACTACAAAGTTTCTGAGAAGG - Intergenic
982132760 4:152245138-152245160 GCACTTCAGTTTCTCTGTGAAGG - Intergenic
984322780 4:178213961-178213983 GAACTCCAGTGTCTCTGGAATGG + Intergenic
984671273 4:182490698-182490720 GAATGACAGAGTTTCTGAGATGG + Intronic
987820831 5:22964240-22964262 GATCCTCTGTGTTTCTGTGAGGG - Intergenic
991651444 5:68859011-68859033 GAATTCCAGTGTTTCTTTAATGG - Intergenic
992073451 5:73169860-73169882 GAACCAGAGAGTTTCTGTGGTGG - Intergenic
993250236 5:85512663-85512685 GAACTACTGTGATTTTGTGGGGG + Intergenic
993845468 5:92937205-92937227 GAACTTCATTGTTTCTGGCAAGG + Intergenic
994134475 5:96269417-96269439 TAACTCCAGTGTTTCTTTGTTGG - Intergenic
994405150 5:99335712-99335734 GAACTACTGTGTTCCTTTGGAGG - Intergenic
995601829 5:113805771-113805793 AAAGAACAGTGTTTCTGTCATGG - Intergenic
995780626 5:115771557-115771579 GAACTACACTAATTCTGTTATGG - Intergenic
997028176 5:130090838-130090860 GATTTACAATGTTTCTGTGTTGG - Intronic
998986724 5:147766157-147766179 GGCCTACAGTGTCTCTTTGAGGG - Intronic
1004003656 6:11619624-11619646 AAACTACAGTGTTTTAATGATGG + Intergenic
1004169951 6:13288155-13288177 GCACTGAAGAGTTTCTGTGAAGG + Exonic
1010164264 6:72897197-72897219 GAATTACATGGCTTCTGTGATGG + Intronic
1012549121 6:100451726-100451748 TTACTTCAGTGTTTCAGTGAAGG + Intronic
1012974326 6:105763702-105763724 GAATCACAGTGTTTGTGTGGGGG - Intergenic
1013027185 6:106287237-106287259 GAGCCACTGTGTTTCTTTGAAGG - Intronic
1015655896 6:135518790-135518812 AAAGTACAGTGTTTCTGGGGAGG - Intergenic
1017565562 6:155681472-155681494 GAACTACCTGTTTTCTGTGAAGG - Intergenic
1020403044 7:7799515-7799537 CAAATATAGTGTTTGTGTGATGG + Intronic
1020582318 7:10018531-10018553 GAATTACAGAGTTTCTTTGCTGG - Intergenic
1020793739 7:12658490-12658512 GAACAACATTGTTTCTCAGAAGG - Intergenic
1022703929 7:32785824-32785846 GAGCCACAGTGTTTCTGAGGAGG - Intergenic
1022908172 7:34875953-34875975 GAGCCACAGTGTTTCTGAGGAGG - Intronic
1027493946 7:78863979-78864001 GAAGTACAGTGTTCATTTGATGG + Intronic
1028351693 7:89857497-89857519 AAGCTAGAGTGTTTCTGTAAAGG - Intergenic
1030810694 7:113968886-113968908 GTAGTAGAGTGTTTCTGTGCTGG - Intronic
1032326492 7:130933834-130933856 GGTCTACAGTGTTGCTGTAATGG + Intergenic
1032447569 7:131997730-131997752 GCTCTACAGTTTTTCTGTAAAGG + Intergenic
1043589688 8:81815249-81815271 TAACTACATTGTTTCTTGGATGG - Intronic
1043723238 8:83575229-83575251 GAACAGCAATGTTTCAGTGAAGG + Intergenic
1045667724 8:104508089-104508111 GTGCTACACTGTCTCTGTGATGG + Intronic
1046567162 8:115916847-115916869 AAACTCCAGTGTCTCTGTGATGG + Intergenic
1048256507 8:132908927-132908949 GAAGGTCAGAGTTTCTGTGATGG + Intronic
1048319845 8:133389877-133389899 GGACTACAGTGTATCTCTGGTGG + Intergenic
1051801900 9:20944283-20944305 AAACTACAGCATTTCTGTAAGGG + Intronic
1055320284 9:75077023-75077045 GAACTTCACTATATCTGTGAAGG - Intronic
1056052197 9:82780763-82780785 TAACTCCAGTATTTTTGTGATGG - Intergenic
1061175019 9:128990021-128990043 GACCCACAGTGTGTATGTGAAGG - Intronic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1187004027 X:15214026-15214048 GAGCTAGAGAGCTTCTGTGAGGG - Intergenic
1188159575 X:26783614-26783636 AAGCTAGAGTGTTTCTGCGAAGG + Intergenic
1188565206 X:31519290-31519312 GAACCACAGTGATTCTCTGGAGG - Intronic
1188589853 X:31820541-31820563 GAACAAGAGTCTTTCTTTGAAGG - Intronic
1189381572 X:40506221-40506243 GAACAACAGGGTTAATGTGAGGG + Intergenic
1189483071 X:41407982-41408004 TAATTACAGTCTTTCTGAGAGGG - Intergenic
1189888549 X:45575863-45575885 GAATTACTGTGTTTCTCTGAGGG + Intergenic
1190510428 X:51168889-51168911 GAACTAATGTTTTTCAGTGAAGG - Intergenic
1191160840 X:57328598-57328620 GAACTAGTGTGTTTGTGTGGAGG + Intronic
1191758573 X:64622717-64622739 AAACTATTGTGTTTCTTTGATGG - Intergenic
1192350411 X:70351242-70351264 GAAGTACAGTATTTAGGTGACGG - Intronic
1195210791 X:102651333-102651355 GAACTATGGTGGTTCTGTGAGGG + Intergenic
1199324848 X:146486762-146486784 GAATTATCGTGTTCCTGTGAGGG + Intergenic
1201345952 Y:12984916-12984938 GAGCTGCAGTGTTTCTCTCATGG - Intergenic
1201530051 Y:14981867-14981889 GATCTTGAGTGTGTCTGTGAGGG - Intergenic