ID: 909162093

View in Genome Browser
Species Human (GRCh38)
Location 1:72165298-72165320
Sequence TTAGTAAGAAGCAAAATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909162092_909162093 7 Left 909162092 1:72165268-72165290 CCATATTTTGATATACAGAAGAT 0: 1
1: 0
2: 1
3: 28
4: 335
Right 909162093 1:72165298-72165320 TTAGTAAGAAGCAAAATAGTTGG 0: 1
1: 0
2: 1
3: 28
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909162093 Original CRISPR TTAGTAAGAAGCAAAATAGT TGG Intronic
902120761 1:14163521-14163543 GCACTAAGAAGCAAAATGGTGGG - Intergenic
902410391 1:16208502-16208524 TTAGTGATAAGGAAACTAGTGGG - Intronic
904808575 1:33148633-33148655 TTAATATGAAGGAAAATAGAAGG - Intronic
906735709 1:48125099-48125121 TTATTAAAAAGTAAAAAAGTGGG + Intergenic
907596515 1:55725362-55725384 TGAGTAAGAAGCAGAATCTTGGG - Intergenic
908104864 1:60831015-60831037 TTAGAAAGAAGGAAAATAAATGG - Intergenic
908740299 1:67320643-67320665 TTAGGAAGAAATAAAATAATTGG - Intronic
909162093 1:72165298-72165320 TTAGTAAGAAGCAAAATAGTTGG + Intronic
909323995 1:74325746-74325768 TTAGGAGGAAGGACAATAGTTGG + Intronic
909515704 1:76504838-76504860 TTAATAAGAAGCATATTAATAGG + Intronic
909892841 1:81029358-81029380 ATAGTAAGAAACACAATAATGGG - Intergenic
910059700 1:83075077-83075099 TTAATAAGAAGAGAAATAGGAGG + Intergenic
911127816 1:94357343-94357365 TTAGTAAGTAGGCAAACAGTAGG + Intergenic
911435535 1:97852630-97852652 TGAGTAAGACGAAAAATAGTTGG - Intronic
911747168 1:101452743-101452765 GTACTAAGAGGCAAAATGGTGGG + Intergenic
912073883 1:105848666-105848688 TTATTAAGAATAAAAATACTAGG + Intergenic
912106250 1:106279940-106279962 TTAGTAAGAAGTATACTAGCTGG + Intergenic
912774257 1:112494766-112494788 TTAGAGAGAAGCAAAATAATAGG + Intronic
914773177 1:150709990-150710012 TTAGTAAAAAGGAATGTAGTAGG - Intronic
916780912 1:168027914-168027936 TTTTTAAGAAACAAAATTGTAGG + Intronic
917174977 1:172223999-172224021 TCAGTAAGCAGCAAAGCAGTTGG - Intronic
919545752 1:198916110-198916132 GAAATAAGAAGCAAAATAGGTGG - Intergenic
920839516 1:209542380-209542402 ATAGTAAGAAGCAGAATGATTGG - Intergenic
921989810 1:221352884-221352906 ATAGTAAAAAGCAGAATAGATGG - Intergenic
922016128 1:221649548-221649570 ATAATAAATAGCAAAATAGTAGG + Intergenic
922348607 1:224717566-224717588 ATAGGGAGAAGCAAAATAGAAGG - Intronic
922484942 1:225966635-225966657 TTAGTAAAAAGGAATGTAGTAGG - Intergenic
1065252459 10:23829904-23829926 TTAGTGGGAAGAAAAATGGTAGG + Intronic
1066527904 10:36301130-36301152 TAAATAAGCAGCACAATAGTGGG + Intergenic
1067055465 10:43047356-43047378 TTTGGAAGAAGAAAAATAGGAGG + Intergenic
1067336560 10:45370967-45370989 TGGGGAAGAAGCAAAATATTGGG + Intergenic
1067421349 10:46152540-46152562 GTAGAAAGAAAAAAAATAGTGGG + Intergenic
1067506688 10:46858999-46859021 GTAGAAAGAAAAAAAATAGTGGG + Intergenic
1067816955 10:49486424-49486446 TTAGTAAGATAAAAATTAGTGGG + Intronic
1068884470 10:62084268-62084290 TTATTAAAGAGCAAAATATTAGG + Intronic
1071194456 10:83141646-83141668 CAACTGAGAAGCAAAATAGTTGG + Intergenic
1071424844 10:85538995-85539017 TCATTAAGAGGCAAAGTAGTTGG + Intergenic
1072316314 10:94206647-94206669 TTAGCAAATAGCAAAGTAGTTGG + Intronic
1073686423 10:105759375-105759397 TTAGAAAGAAGCAAGAGAGTAGG - Intergenic
1073827333 10:107339223-107339245 TGGGTAAGAAACAAAATAATAGG - Intergenic
1074666890 10:115737761-115737783 TTAGAAAGAAGCAGAATTGGGGG - Intronic
1074929050 10:118104623-118104645 TTAGTATGGACCAAAATAGTTGG - Intergenic
1076441731 10:130485161-130485183 TTATTAAAAAAAAAAATAGTTGG - Intergenic
1077591922 11:3499049-3499071 TGTGTAAGAATCATAATAGTGGG - Intergenic
1079677999 11:23256336-23256358 TTAAAAAGAAATAAAATAGTGGG + Intergenic
1082683921 11:56215168-56215190 TTAGAAAGAAGTAAAATATTTGG + Intergenic
1084247761 11:67871785-67871807 TGTGTAAGAATCATAATAGTGGG - Intergenic
1085193356 11:74648648-74648670 TTAGTGAGAGGCAGAATGGTTGG + Intronic
1087191691 11:95261098-95261120 TTAGTGAGATGCAAAATCTTAGG + Intergenic
1088009384 11:104980968-104980990 TTAGTAAGAAGGAACATATAAGG + Intergenic
1088052575 11:105535766-105535788 TCAGTAAGATGAAATATAGTAGG - Intergenic
1088370949 11:109088190-109088212 TTAGTAAAAAGCATTATAGTTGG + Intergenic
1088975618 11:114813791-114813813 TTAGAAAGAAGAAAAACATTGGG + Intergenic
1089240025 11:117069684-117069706 TTATTAAGAAGGAGAATAGAGGG - Intronic
1089781059 11:120873598-120873620 TTAGGAAGAAACAATATCGTGGG + Intronic
1093102071 12:15039183-15039205 TTTGATAGAAGCAAAATAGTTGG + Intergenic
1093624583 12:21329827-21329849 TTACTAAGAGTTAAAATAGTAGG - Intronic
1095316803 12:40772459-40772481 CTAAGAAGAAGCAAAATAGAGGG + Intronic
1095918655 12:47506870-47506892 TTAGTGAGATGCAAAATATTAGG + Intergenic
1095985886 12:47999353-47999375 TAATTCAGAAGCAAAATAATAGG - Intronic
1097788566 12:63789017-63789039 TTAGTAATAAGCAGAAAAGAGGG + Intronic
1098827608 12:75317343-75317365 TTAGAAAGAAGTATATTAGTGGG - Intronic
1098995848 12:77118951-77118973 CTAGTAAGAAGGAAAATACAAGG + Intergenic
1099409092 12:82302333-82302355 TTAGAAAGAAGTAATATATTTGG + Intronic
1100105792 12:91170234-91170256 TTATTAATAAGCAAAATAGAGGG + Intronic
1100821371 12:98433857-98433879 TTAGTATGAAACAAAAAAGAAGG + Intergenic
1101001955 12:100365588-100365610 TAAGGAAGAAGCACAATGGTTGG - Intronic
1102899692 12:116626705-116626727 TTAGAAAAAAGTAAAATAGATGG + Intergenic
1103283609 12:119781662-119781684 TTAGAAAGAAAAAAAAGAGTGGG + Intronic
1105672762 13:22638439-22638461 TTAGGGAGAAGCAAAGTAGGAGG - Intergenic
1106117906 13:26832753-26832775 TTACTAAGAATCGGAATAGTGGG + Intergenic
1106393103 13:29354778-29354800 GTACTAAGTAGGAAAATAGTGGG + Intronic
1107572653 13:41679570-41679592 TTAGCTAGAAGAAAAACAGTTGG + Intronic
1108833395 13:54507624-54507646 TTAGTAAGAAGAACCATAGATGG + Intergenic
1108878539 13:55079448-55079470 TTCATAAGAAACAAAATAATAGG + Intergenic
1112761953 13:102701415-102701437 CTAGTAAAAAGCAAAGTATTTGG + Intergenic
1112925970 13:104675947-104675969 TTAGGAAGAAGGTAAATATTTGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114887820 14:26876704-26876726 TTGGTAAGGAGCACAAAAGTTGG - Intergenic
1114951453 14:27759984-27760006 CTAGTAAGAAGAAAAATATAGGG - Intergenic
1114978488 14:28131497-28131519 TCAGTAAGAAGCAAGACAATAGG + Intergenic
1114992729 14:28308182-28308204 TGAGTAAGGAGCAACATATTAGG + Intergenic
1116705933 14:48300101-48300123 ATACTAAGAAGAAAAATATTTGG - Intergenic
1118210967 14:63765294-63765316 TTAGCAAAAAGCAAAAAAGATGG - Intergenic
1120482937 14:85075261-85075283 TTAAAAAGACACAAAATAGTGGG - Intergenic
1121857772 14:97285987-97286009 TTTGTCAAAAGCAAAATAGGTGG + Intergenic
1122684777 14:103496723-103496745 TTAATAAAAAGAAAAAAAGTTGG + Intronic
1124660235 15:31542459-31542481 TAAGTAAGAAGCAACAAAGAGGG + Intronic
1125220839 15:37333074-37333096 GTAGTAAGAAGCAAAACCATGGG - Intergenic
1126711434 15:51461303-51461325 TAAGGAAGAAGCAAACTCGTGGG + Intronic
1126749250 15:51859948-51859970 TTACTAAGAAGACAAATAGTGGG - Intronic
1127317987 15:57815560-57815582 CTTTTAAGAAGCAAAATATTGGG - Intergenic
1127559275 15:60119837-60119859 ATAGAAATAAGCAAAATAATGGG - Intergenic
1128518250 15:68357554-68357576 TAAGAAAGAAGCATAATTGTTGG - Intronic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1130209005 15:81906021-81906043 TTATTCAGAAGCAAAACATTTGG + Intergenic
1131950853 15:97680529-97680551 TTTTTAAGCTGCAAAATAGTAGG + Intergenic
1133541821 16:6763275-6763297 TTAGTGAGAAGCAAAGTCATTGG + Intronic
1134321933 16:13171667-13171689 TTAGCAAAGAGCAAAAAAGTGGG + Intronic
1135564481 16:23500825-23500847 ATGGTCAGAAGCAAAATATTTGG - Intronic
1135875109 16:26191580-26191602 TTGGGATGAAGAAAAATAGTAGG + Intergenic
1135918320 16:26625718-26625740 GCATTAAGAGGCAAAATAGTTGG - Intergenic
1137948139 16:52755633-52755655 TCAAAAGGAAGCAAAATAGTGGG + Intergenic
1139197301 16:64934485-64934507 TTGGTAAGAAACACAGTAGTTGG + Intergenic
1140176893 16:72670110-72670132 TTTTAAAGAAGAAAAATAGTTGG + Intergenic
1144260560 17:13515653-13515675 ATAGTAAGGAGCAAAATTGCTGG + Intronic
1145198371 17:20916646-20916668 TTAGTAAGAAACAAAAAATTGGG - Intergenic
1146325014 17:31878717-31878739 TTACTAAGAAGTCAAATAGTGGG - Exonic
1146538312 17:33672602-33672624 TCATTAAGAAACAAAATATTAGG - Intronic
1149143653 17:53463901-53463923 TTTGTAAAAAGCAAATTAGATGG - Intergenic
1150140318 17:62722999-62723021 TTAGTGAGGACCAAAATAGATGG + Intronic
1150634456 17:66903248-66903270 TTATTAAGAAGCAACATGCTGGG + Intergenic
1151095231 17:71489975-71489997 TTAGTAAGAAAAATAAAAGTTGG - Intergenic
1151102587 17:71572850-71572872 CTAGTGGGAAGCTAAATAGTTGG + Intergenic
1153649414 18:7226549-7226571 TTATTAAGGAGCACAATTGTGGG - Intergenic
1153734725 18:8053793-8053815 TTAGTGAGGACCAAAATAATTGG - Intronic
1153840203 18:9000522-9000544 TCAGGAAGCAGGAAAATAGTGGG + Intergenic
1156578650 18:38349735-38349757 CTAAGAAGAAGCACAATAGTAGG - Intergenic
1156728064 18:40154340-40154362 TTAGTAAGATGCAAAACAATTGG - Intergenic
1157352664 18:46903112-46903134 TTAATAAGCAGGAAAATATTTGG + Intronic
1157364408 18:47050528-47050550 TTTGTAAGCAGCAAACTACTTGG - Intronic
1158287047 18:55895497-55895519 TTAGAAAGAACCAAATTACTAGG + Intergenic
1159141100 18:64396089-64396111 TAAGTAAAAGGCAAAGTAGTAGG - Intergenic
1159801433 18:72905435-72905457 TTTTTAAGAAGGAAAAGAGTGGG + Intergenic
1162689357 19:12416097-12416119 TTTGTAAGAATCAACACAGTAGG - Intronic
1165157868 19:33798643-33798665 TAAGTCAGAAGCACAAAAGTGGG - Exonic
926472688 2:13280631-13280653 TTATTAAGGAGCAAAGAAGTAGG + Intergenic
927280745 2:21304128-21304150 CTAGTTAGAAGCAAAATAAATGG + Intergenic
928262120 2:29777469-29777491 CTAGCAATAAGCAAAATAGATGG - Intronic
928747337 2:34431186-34431208 ACAGCCAGAAGCAAAATAGTAGG - Intergenic
929073746 2:38060239-38060261 TTAATAAAAAACAAAATGGTCGG - Intronic
929327595 2:40635921-40635943 TTAGTGAGAAGCAAGCTAGAGGG - Intergenic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
930051495 2:47219495-47219517 TTTGTAGAAGGCAAAATAGTCGG + Intergenic
931324473 2:61204652-61204674 TTTGTAAGATGGAAAGTAGTAGG - Intronic
931506536 2:62933676-62933698 TAAGAAAGAAGCATAAAAGTGGG + Intronic
932065923 2:68559923-68559945 ATAGTAAAAATGAAAATAGTAGG - Intronic
935894135 2:107715478-107715500 TTAGTAAGAAACACAAGAATAGG - Intergenic
938284961 2:130104862-130104884 TTAGTGAGAGTCAAACTAGTAGG + Intronic
938334458 2:130478875-130478897 TTACTGAGAATCAAACTAGTAGG + Intronic
938335605 2:130493409-130493431 TTAGTGAGAGTCAAACTAGTAGG + Intronic
938354219 2:130627254-130627276 TTAGTGAGAGTCAAACTAGTAGG - Intronic
938430643 2:131234029-131234051 TTAGTGAGAGTCAAACTAGTAGG - Intronic
938758972 2:134406545-134406567 TCAGTAAGAAGAGACATAGTTGG - Intronic
939105895 2:137948147-137948169 TTAGTAAGAAGCAGATTAATTGG - Intergenic
939242960 2:139585666-139585688 ATAGTAATAAACAAAATAGATGG + Intergenic
939402672 2:141714825-141714847 TTAGAAAGATGCAGAATAATGGG + Intronic
939920365 2:148103201-148103223 TCAGTAAGTAGCAACGTAGTTGG - Intronic
939957989 2:148542640-148542662 TAAGCAAGAAGGTAAATAGTAGG - Intergenic
940505620 2:154549274-154549296 TTAGTAAGAATCAAAGAGGTAGG - Intergenic
940727897 2:157356014-157356036 CTAGTCAGAAGCAGAACAGTTGG - Intergenic
940945726 2:159615739-159615761 TTTTTAAGAAGCAAAACTGTTGG + Intronic
942447749 2:176089381-176089403 CTTGTAAGAAGCCAAATATTTGG - Intergenic
942467727 2:176226049-176226071 TTGGTTAGAAGCAAATTACTAGG - Intergenic
943716467 2:191158022-191158044 TAAGTAAAAAGTAAAATATTGGG - Intergenic
944572156 2:201055763-201055785 TTAGAAAGAAGCACAATGCTGGG + Intronic
944807631 2:203298084-203298106 CTAGTAAGTAACAAAATATTGGG + Intronic
945003489 2:205377203-205377225 TTAGTTAGAAGGAAGAGAGTGGG + Intronic
945567732 2:211423676-211423698 TTAGTCAGGAGCAAATTAGCAGG - Intronic
946567114 2:220978858-220978880 TCAGTAAGAAGCAACATGCTGGG + Intergenic
947356955 2:229306726-229306748 CTAGTAACAATCAAAATAGGAGG - Intergenic
947414193 2:229876645-229876667 TAAGTAATAAACAAAGTAGTGGG - Intronic
948910764 2:241001416-241001438 TGAGAAAGAAGCAAAACAATGGG - Intronic
1169317159 20:4602275-4602297 TTACTAATAAGCCAAATATTTGG + Intergenic
1170132572 20:13037155-13037177 TATGTAAGAATAAAAATAGTTGG - Intronic
1171077881 20:22147732-22147754 TTAGTAGGAAGAAAAAGAGAAGG + Intergenic
1171782516 20:29432403-29432425 TAACTAAGAAGGAAACTAGTTGG + Intergenic
1172001491 20:31781612-31781634 TTAATAACAAGCAAAATAATTGG + Intronic
1173335751 20:42111229-42111251 TTGCTAAGTAGAAAAATAGTAGG - Intronic
1173464855 20:43272685-43272707 TTTGTAAGAAATAAAATTGTTGG + Intergenic
1173969287 20:47139132-47139154 TTAGTAAATAGCAAAAGATTGGG - Intronic
1174921557 20:54708225-54708247 TGAGTATGCAGGAAAATAGTAGG + Intergenic
1174992697 20:55529254-55529276 TTAGTAAAAAGAAAAATGATAGG + Intergenic
1177072864 21:16532551-16532573 TTAAAAAGAAGCAAAGTAATGGG - Intergenic
1177418470 21:20825291-20825313 TTAGTAAGAACTATATTAGTCGG + Intergenic
1177514328 21:22128959-22128981 TTAGTAAAATGCAAATTAGGTGG - Intergenic
1177873917 21:26608007-26608029 TTAGGAAGAAGGAAAAGTGTGGG + Intergenic
1181394556 22:22610566-22610588 TGAGTCAGAAGTAAAAAAGTTGG + Intergenic
951272007 3:20637057-20637079 TTCTGAAGAAACAAAATAGTAGG - Intergenic
953095687 3:39773471-39773493 TTAGAAAGAATAATAATAGTAGG + Intergenic
954545332 3:51429471-51429493 CTATTAAGATGCAAAATATTGGG + Intronic
957082967 3:75653981-75654003 TAACTAAGAAGGAAACTAGTTGG - Intergenic
957509074 3:81164332-81164354 TTAATGAGAAGCAGAATAGAAGG - Intergenic
959173423 3:102872553-102872575 TTCTTAAGCAGCAAAATATTTGG + Intergenic
959225912 3:103584440-103584462 TTAGTAAAAAGCAAATAACTTGG + Intergenic
959259586 3:104059150-104059172 TGATTAGGAAGCAAAATAATGGG + Intergenic
960020878 3:112951586-112951608 TATGTAAGAAGTAAAATATTAGG + Intronic
961291433 3:125849791-125849813 TGTGTAAGAATCATAATAGTGGG + Intergenic
961608635 3:128118100-128118122 TTAGGAAGAAGAAAAATGGAGGG + Intronic
963719573 3:148845624-148845646 TTGGTAAGTAGCAAAGTAGTAGG + Exonic
964022569 3:152031628-152031650 TTTGTAAGAAGAAAAACTGTGGG + Intergenic
964254437 3:154760245-154760267 TTTGTAAAATGCAAAATATTTGG - Intergenic
964296850 3:155242574-155242596 TTAGAATGAATCAGAATAGTTGG + Intergenic
965182605 3:165423997-165424019 TTAGTAAAATGTAAAATATTTGG - Intergenic
965376107 3:167926309-167926331 GTATTAAGAGGCAAAATGGTGGG + Intergenic
965401665 3:168219917-168219939 TTAGTGAGAAAGAAAAGAGTGGG - Intergenic
966200003 3:177352233-177352255 TTTGTTAGAAGCATAAAAGTAGG + Intergenic
967099311 3:186203041-186203063 TTAGTAAGAAATAAAAAAGAGGG + Intronic
967125673 3:186422147-186422169 TTAGGAAGAAGCTATATGGTAGG + Intergenic
969747030 4:9080559-9080581 TGTGTAAGAATCATAATAGTGGG + Intergenic
970066472 4:12100118-12100140 TTAGTAAGAAAAAAAGTATTGGG - Intergenic
970541133 4:17081033-17081055 TTATTTAGAAGAAATATAGTTGG + Intergenic
970624952 4:17866425-17866447 TTAGACACATGCAAAATAGTGGG - Intronic
972215713 4:36895090-36895112 TTAATAGGAAGCAGAATAGATGG - Intergenic
974522239 4:62996632-62996654 CTACTAAAAAACAAAATAGTTGG + Intergenic
975065846 4:70062637-70062659 TTACTAAGAGTTAAAATAGTAGG - Intergenic
975746256 4:77478253-77478275 TTATTAAAAAGTAAAATAATGGG + Intergenic
975755351 4:77566647-77566669 TTAGTAAGACATAAAATACTAGG + Intronic
975903582 4:79182583-79182605 TTTTTAAGAAGCAAAATGTTTGG + Intergenic
976022189 4:80642463-80642485 TTAGTTAAAACAAAAATAGTTGG + Intronic
976450013 4:85178055-85178077 TTAATAAAAAGCAATATATTTGG + Intergenic
976883416 4:89958176-89958198 TTAGTATGAATCAAAAAAATAGG - Intergenic
977664648 4:99631958-99631980 TTAGGAAGAATCAAAACAGAGGG + Intergenic
978901938 4:113961705-113961727 AAAATAAGAAGCAAAATAGGTGG + Intronic
978997051 4:115169799-115169821 TGAGTTATAAGCAAACTAGTGGG - Intergenic
979281061 4:118868747-118868769 TTAGAAAGAAGGAAAATGGAAGG + Intronic
979386554 4:120072240-120072262 TAAGTAAGAAGCAAATTAAATGG - Intergenic
979898023 4:126185632-126185654 TTAGTAAGAAGTGAAATGATAGG + Intergenic
980375006 4:131934167-131934189 ATAGTAAGAATAAAAATAATGGG + Intergenic
980552936 4:134363897-134363919 TTCTAAAGAAGAAAAATAGTTGG - Intergenic
982852253 4:160333748-160333770 TTAGTAAGAAGAAAAAAATAAGG + Intergenic
983653142 4:170053405-170053427 GAAGGAAGCAGCAAAATAGTAGG - Intergenic
985419250 4:189766956-189766978 TTATTAAGAAGCAAAACTGTTGG - Intergenic
985933050 5:3074080-3074102 TTAGTTAGAAGCAAAGTCTTTGG + Intergenic
987974502 5:24995522-24995544 ATAGGAAGAATCAAAATACTAGG + Intergenic
989596589 5:43161827-43161849 TCAGTAAGAAGCAAAGAACTGGG + Exonic
990080962 5:51913133-51913155 TTAGTAAGAAATACAAAAGTAGG - Intergenic
990081663 5:51923481-51923503 TTAATAATAAGTAAAATAGTTGG + Intergenic
990232791 5:53732913-53732935 TAGGTAAAAAGTAAAATAGTGGG - Intergenic
990550888 5:56877179-56877201 TAAGTAAGAGGCAAAATATTGGG - Intronic
991547091 5:67794800-67794822 TTATTAAGTAGCAAAAAACTCGG + Intergenic
992500716 5:77340248-77340270 TTAGAAAGAATCAAAATTTTTGG + Intronic
993934132 5:93980129-93980151 TTAATAAGAAGAAAGAAAGTGGG - Intronic
995095488 5:108230950-108230972 TTAAAAAAAAGCAAAATAGTAGG + Intronic
995143608 5:108761772-108761794 TTCTTAATAAGCAAAATAGCTGG - Intronic
996009647 5:118467784-118467806 TTAGAAAGAAGCTAAACAGATGG - Intergenic
996987830 5:129588975-129588997 TTAATAACTAGCAAAATAATAGG - Intronic
997416146 5:133730318-133730340 ACAGTGAGAAGAAAAATAGTTGG - Intergenic
997723394 5:136099131-136099153 TAAGTAAGAATCAAAATATGTGG + Intergenic
997781687 5:136666101-136666123 TTAGGAAGAAGTAGAATTGTGGG + Intergenic
998907308 5:146919843-146919865 CTTGTAATAAGAAAAATAGTTGG + Intronic
1000262674 5:159602945-159602967 TTACTAAGAAGAAATATAGGAGG - Intergenic
1003743900 6:8977653-8977675 TTTCTCAGAAGCAAAATATTGGG + Intergenic
1004978615 6:20996798-20996820 TTTGTAAGAAACACAATATTTGG + Intronic
1004996544 6:21199064-21199086 TAAGAAAGAAGCAAAAAAGTAGG - Intronic
1007869165 6:45013247-45013269 GTAGCAAAAAGCAAAACAGTGGG - Intronic
1007983671 6:46185747-46185769 TTACTAAGAATAAAAAGAGTTGG - Intergenic
1008113933 6:47525175-47525197 TTAGTCAGAGCTAAAATAGTTGG + Intronic
1008287330 6:49669994-49670016 TAAGTAAGGTGGAAAATAGTGGG - Intergenic
1010873518 6:81071115-81071137 TTAGAAAGAGCCAAAATGGTAGG - Intergenic
1011176466 6:84566219-84566241 TAAGTAAAAGGCAAACTAGTTGG + Intergenic
1011443321 6:87410434-87410456 TCAGTAATAAGAAGAATAGTTGG + Intronic
1013220942 6:108076396-108076418 TTACTAAGAAACTGAATAGTAGG + Intronic
1013672062 6:112415276-112415298 TTAGTCACAAGCTAAATAATTGG - Intergenic
1013700435 6:112762317-112762339 TTAGGAAGTAGTTAAATAGTAGG - Intergenic
1015155208 6:130086356-130086378 ATAGGAATAAGCAAAATAATTGG + Intronic
1017142066 6:151200083-151200105 TTAATAAGAAGAAAAAGATTGGG - Intergenic
1017357271 6:153524391-153524413 TTAGAAAAAAGCAAAATGTTTGG + Intergenic
1021278495 7:18686394-18686416 TTAGTATGAAGGAAAAAAGCAGG - Intronic
1021955301 7:25818414-25818436 CTAGAAATAAGCAAAATATTGGG + Intergenic
1023269749 7:38449709-38449731 TTAGTAAGATGAAAATTAGAAGG - Intronic
1023459509 7:40379771-40379793 TTAGTAAGAAGTGAAATTGTAGG + Intronic
1024179720 7:46879513-46879535 TTAGAAAGAAGAGAAATAGATGG - Intergenic
1024887791 7:54164176-54164198 TCACCAAGAAGTAAAATAGTAGG - Intergenic
1026073583 7:67144979-67145001 CCAGCAAGAAGCAAATTAGTAGG - Intronic
1026703303 7:72667201-72667223 CCAGCAAGAAGCAAATTAGTAGG + Intronic
1027469191 7:78552477-78552499 TGAGTTAAAAGGAAAATAGTCGG - Intronic
1027688436 7:81308696-81308718 TAGGTAAGAAGCAAAGTAGCAGG + Intergenic
1028187144 7:87800216-87800238 TGAGGAAGAAGCAAAGTAGAGGG + Intronic
1028513848 7:91654761-91654783 AAAGAAAGAAGTAAAATAGTGGG - Intergenic
1029237161 7:99130601-99130623 GTAGTATGAAGCAAAAGATTTGG - Intronic
1029282129 7:99442354-99442376 TTATTAACAAGCAACATAATCGG + Intronic
1030186084 7:106763447-106763469 TTAGTAATAATTCAAATAGTGGG - Intergenic
1030484282 7:110146951-110146973 TTTGTAAGAAACAAAATAATGGG + Intergenic
1030937664 7:115605513-115605535 TTTGTAGGGAGCAAAATAGCTGG + Intergenic
1031061069 7:117051970-117051992 TTGGTAAGAAGCAAGAGAATGGG - Intronic
1031130446 7:117827492-117827514 TTTGTAAGAAGCTTAATATTGGG - Intronic
1031572734 7:123379030-123379052 TTAGGAAGAAGCAAAGAAGTAGG + Intergenic
1033281236 7:140007912-140007934 TTTGAACGAAGCACAATAGTTGG - Intronic
1035434235 7:158847231-158847253 TTACTAAGAATTAAAAAAGTAGG + Intergenic
1037084653 8:14833704-14833726 ATAGGAAGAAGCAGCATAGTTGG + Intronic
1038055112 8:23850761-23850783 TTTGTAAAAAGCAAAATGGCTGG - Intronic
1039377558 8:37051191-37051213 TTATGAAGAAACCAAATAGTGGG - Intergenic
1039666112 8:39530401-39530423 TTAGGAAAAAACAAATTAGTGGG + Intergenic
1040821414 8:51562669-51562691 GTAATAAAAATCAAAATAGTTGG + Intronic
1042400049 8:68334612-68334634 TTACTAAGAAGCCAAATAGTGGG + Intronic
1043568551 8:81574796-81574818 TCACTAAGAAACAAAACAGTAGG - Intergenic
1043924990 8:86026753-86026775 TTACTGTGAAGCAAAAGAGTTGG - Intronic
1044011156 8:86995561-86995583 TTAGTAAAAAGAAAAATAAGGGG + Intronic
1044603911 8:94032630-94032652 TTAGTAAGTAGCAACATTGAGGG + Intergenic
1044806648 8:96015275-96015297 TTTGGAAGAAGAAAAATAGGAGG - Intergenic
1046110954 8:109723807-109723829 TTAGTAGGATGCAAAATTCTTGG - Intergenic
1046900324 8:119516707-119516729 TTGGTAAGAAACAATATTGTTGG + Intergenic
1047534158 8:125704029-125704051 TTAGTAACAAGCAAATTAAGGGG + Intergenic
1048933712 8:139338272-139338294 TTAGCAAGAAGGAAAATGGATGG - Intergenic
1051096213 9:13468427-13468449 TTATTAAGAATTAAAATATTTGG - Intergenic
1052092417 9:24345210-24345232 TTATTAAGTAGCAAAATACTTGG - Intergenic
1054749663 9:68892328-68892350 TGAAAAAGAAGAAAAATAGTAGG + Intronic
1054834291 9:69660183-69660205 TTATTAAGAAGAAAAACAGGAGG + Intronic
1055159401 9:73106995-73107017 TTACTTAGAATAAAAATAGTTGG - Intergenic
1057538895 9:95945895-95945917 TTAGAAAGAAGGAGAAAAGTGGG + Intronic
1059581425 9:115552993-115553015 ATATGAAGAAGCAAAATAGAAGG - Intergenic
1059679710 9:116574306-116574328 TAAGTAAGAAGGAAAAAGGTAGG + Intronic
1060494634 9:124109317-124109339 ATAGGAAGACACAAAATAGTTGG + Intergenic
1060609015 9:124944111-124944133 TTAAAAATAAGCAAAAAAGTTGG + Intronic
1062200932 9:135302240-135302262 TTAGCCTGAATCAAAATAGTCGG + Intergenic
1186925580 X:14330034-14330056 CTAGTAAGTAGCAAAATAGGGGG + Intergenic
1187848915 X:23571327-23571349 TTCCTCACAAGCAAAATAGTTGG - Intergenic
1188142959 X:26574927-26574949 TTAGAAAGAAGCAGACTAGTAGG - Intergenic
1188904462 X:35775374-35775396 TTACTAAGAGTTAAAATAGTAGG - Intergenic
1188948987 X:36345040-36345062 TTAGTCAAAAGCAAAGGAGTAGG + Intronic
1189678901 X:43493629-43493651 ATAGCAAAAAGCAAAAAAGTGGG - Intergenic
1192066792 X:67893092-67893114 TTACTAAGAATTAAAATAGTAGG - Intergenic
1193772781 X:85606823-85606845 TAAGTAAGAGGGAGAATAGTGGG - Intergenic
1193799738 X:85920419-85920441 TGGGTAAGAAGCACAGTAGTAGG + Intronic
1195145657 X:102013971-102013993 TAAGTAAGAAGAAAAATAAAAGG + Intergenic
1195437406 X:104861271-104861293 TTAGTAAGCAGATAAATAATTGG - Intronic
1195924288 X:110010200-110010222 ATATTAAGAAGCAAGAAAGTTGG - Intronic
1196487436 X:116229207-116229229 TTTCTAAGGAGAAAAATAGTTGG + Intergenic
1197022435 X:121707518-121707540 TTGGTAAGAAGCAATTTGGTAGG + Intergenic
1197546400 X:127830318-127830340 TAAGGAAGAAGGAAACTAGTGGG - Intergenic
1197629168 X:128838021-128838043 CTAGTATGAAGTAGAATAGTAGG - Intergenic
1197663259 X:129196381-129196403 TTTGTTAAAAGCAACATAGTAGG + Intergenic
1199205640 X:145145681-145145703 GTAGTCAGAAGCAAAAAAGAAGG - Intergenic
1199803618 X:151275478-151275500 TTATTAAGAAGCAAATATGTTGG - Intergenic
1201408023 Y:13668194-13668216 TTACTAAGAATTAGAATAGTAGG - Intergenic