ID: 909170026

View in Genome Browser
Species Human (GRCh38)
Location 1:72282963-72282985
Sequence CAGCAGCAGCAGAAGCAGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1505
Summary {0: 1, 1: 13, 2: 88, 3: 251, 4: 1152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909170024_909170026 3 Left 909170024 1:72282937-72282959 CCCAGCAGCAGCAGCAGCAACAG 0: 3
1: 44
2: 97
3: 292
4: 1011
Right 909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG 0: 1
1: 13
2: 88
3: 251
4: 1152
909170025_909170026 2 Left 909170025 1:72282938-72282960 CCAGCAGCAGCAGCAGCAACAGC 0: 7
1: 127
2: 258
3: 631
4: 1944
Right 909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG 0: 1
1: 13
2: 88
3: 251
4: 1152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909170026 Original CRISPR CAGCAGCAGCAGAAGCAGCG CGG Intergenic
900091953 1:924508-924530 CAGCGGCGGCAGCGGCAGCGCGG - Intergenic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900351300 1:2236075-2236097 CTGCAGCTGCAGAGGCACCGAGG - Intronic
900413942 1:2526548-2526570 GAGCGGCAGCGGGAGCAGCGGGG - Exonic
900895296 1:5479106-5479128 CAGCAGCAGCACAGGCAGGGAGG - Intergenic
900961790 1:5927075-5927097 CTGCCTCAGCAGAAGCAGCTAGG + Intronic
901104859 1:6747228-6747250 CAGCAGCAGGAGATGCAGCGGGG + Intergenic
901110262 1:6787639-6787661 AAGCAGCAGCAGAAGAATCACGG + Intronic
901587522 1:10310316-10310338 CAGCAGCATCAGAATCACCTGGG - Intronic
902150763 1:14441380-14441402 CAGCAGCAGCAGCAGCACCTGGG + Intergenic
902383015 1:16061436-16061458 CAGCAGCACCTGAAGCAGCTGGG - Intronic
902490109 1:16775348-16775370 CAGAAGCAGCAGGAGGGGCGTGG + Intronic
902582445 1:17416672-17416694 CAGCAGCAGCACAAGCACAAGGG + Intronic
902954638 1:19917157-19917179 CAGCCGCAGAAGCAGCAGCAGGG - Intergenic
902984456 1:20147158-20147180 CAGCAGCAGCTGCAGCACCCAGG + Intronic
903057385 1:20645619-20645641 CAGCAGCTGCAGCAGCATCATGG - Exonic
903190617 1:21653672-21653694 TAGTAGCAGCAGCAGCAGCAGGG + Intronic
903296484 1:22346589-22346611 CAGCTGCAGCAGCAGAAGCTGGG - Intergenic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
903510073 1:23868227-23868249 GAGCAGCAGCAGCAACAGCGCGG + Exonic
903836099 1:26204115-26204137 CAGCAGCAGCAAAATCCGCTGGG - Intergenic
904028862 1:27521553-27521575 CATCAGCAGCAGCAGCAGCAGGG - Intergenic
904946783 1:34205200-34205222 CAGAAGCAGCAGAAGGACCCTGG + Intronic
904961963 1:34340425-34340447 CAGCAGCAACAGCAGCACAGGGG - Intergenic
904991119 1:34593509-34593531 CAGCAGCAGCAGTATCACCTGGG + Intergenic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905402782 1:37715711-37715733 CAGGAGCAGTAGAACCAGGGAGG - Intronic
905534398 1:38708949-38708971 GAGCAGCAGCAGCAGCATCGCGG - Intergenic
905705896 1:40057454-40057476 CAGCAGCAGCAGAAGCCTCCAGG - Intronic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
905824073 1:41016137-41016159 CAGCAGCAGCTGCAGCAGCACGG - Exonic
905850655 1:41272158-41272180 CAGAAGCAGGGGAAGCAGCCAGG - Intergenic
905972652 1:42153491-42153513 CAGCAGCAGCAGGAGGACCACGG - Exonic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906296969 1:44654871-44654893 CAGCAGCAACAGGCGCAGCATGG + Exonic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906678951 1:47712025-47712047 CAGCATCAACAGAAGCAATGCGG + Intergenic
906864737 1:49405543-49405565 GAGCAGCAGCAGTGGCAGCATGG - Intronic
906960929 1:50419145-50419167 CAGCAGCTGCAGACGACGCGTGG - Exonic
907012854 1:50978911-50978933 CAGCACCTGCAGAAGCACAGTGG + Intergenic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907534500 1:55137544-55137566 CTCCAGCAGCAGCAGCAGTGGGG - Exonic
907724995 1:57011526-57011548 AAGCAGCAGCAGTAGCATCTGGG + Intronic
907833419 1:58086738-58086760 CAGCAGAAGCAGAAGTACAGAGG - Intronic
907868606 1:58422854-58422876 CAGCAGAAGCAGCAGAAGCAAGG + Intronic
907886639 1:58598151-58598173 CAGAAGCCACAGAAGCAGGGAGG - Intergenic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908435555 1:64102216-64102238 CAGCACCACAAGAAGGAGCGTGG + Intronic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
908854110 1:68405321-68405343 CAGCAGCAGCAGCAGCAATACGG + Intergenic
908959625 1:69680116-69680138 CAGCAGCAGCAGCAGCATCTGGG + Intronic
909083681 1:71146805-71146827 CAGCTGTAGCTGAAGCAGCTAGG - Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909289549 1:73865137-73865159 CACCAGCAGTAGAACCAGCTGGG - Intergenic
909694421 1:78450056-78450078 CAGGTGCAACAGAAGCAGCATGG - Intronic
909980637 1:82096096-82096118 CAGCAGCAGCAGCATCACCTGGG - Intergenic
910171862 1:84386495-84386517 CAGCAGCAGAGGTAGCAGAGGGG + Intronic
911002406 1:93180177-93180199 CAGCAGCACCGGAGGCAGAGCGG + Exonic
911103488 1:94111902-94111924 AAGCAGCAGCAGCAACTGCGTGG - Intronic
911136753 1:94448863-94448885 CAGCAGTTGCAAAAGCAGAGGGG + Intronic
911539847 1:99145418-99145440 CAACAGCAGCAGGAGCACAGTGG - Intergenic
911644057 1:100320163-100320185 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
911660769 1:100499118-100499140 CAGAAGCAGCAACAGCAACGGGG + Exonic
912236416 1:107855992-107856014 CAGAAGCTGCAGAGGCAGCTAGG + Intronic
912494310 1:110081611-110081633 CAGCAGCAGAAGCAACAGCTAGG + Intergenic
912515030 1:110211748-110211770 CAGCGGCAGCAGCGGCGGCGGGG + Exonic
912518344 1:110229487-110229509 CAGAAGCAGAGGAAGCAGCGTGG - Intronic
912565773 1:110586174-110586196 CAGGAGCAGAAGAAGCAAGGGGG - Intergenic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
912950734 1:114118611-114118633 CAGCAGCAGCAGGAGCCCCAGGG - Intronic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
913181384 1:116325777-116325799 CAGCAGCATCAGAATCACCTGGG + Intergenic
913474331 1:119222649-119222671 AAGCAGCAGCAGATTCAGGGTGG + Intergenic
914455724 1:147834544-147834566 CACCGTCAGCAGAAGCAGTGTGG - Intergenic
914753905 1:150552545-150552567 AAGCAGCAGCAGATACAGCCAGG - Exonic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
914996483 1:152547164-152547186 CAGCTGCAGCACAAGCAGGTGGG - Intronic
915137170 1:153740751-153740773 CAGCAGCAGCAGTGGCTGCAGGG - Intronic
915325331 1:155078982-155079004 CAGCAGCGGCAGCAGCGGCACGG - Exonic
915623819 1:157102348-157102370 CAGCAGCAGCAGCATCACCTAGG - Intergenic
915815774 1:158963162-158963184 CTGCAGCAGCAGTGGCAGAGGGG - Intronic
915828294 1:159102136-159102158 TAGCAGGAGCTGAAGCAGCTGGG - Intronic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916059537 1:161089234-161089256 CAGTAGCAGCAGCAGCAGCCAGG + Exonic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
916482324 1:165225753-165225775 CAGCAGCAGCAGCATCACCTGGG - Intronic
916562609 1:165946154-165946176 CGGCAGCAGTAGCAGCAGCAAGG + Intergenic
916987507 1:170207502-170207524 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
917141659 1:171841569-171841591 CAGCAGCAGCCAGGGCAGCGCGG + Exonic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
917524507 1:175775063-175775085 CAGCAGTGGCAGACGTAGCGTGG - Intergenic
917967519 1:180187810-180187832 CAGTAGCAGCAGAGGCATCGGGG + Intronic
918121294 1:181543234-181543256 CAGCAGCATCAGCATCAGCAGGG - Intronic
918942974 1:191026209-191026231 CAGCAGCTGCAGAGGGGGCGCGG - Intergenic
919371947 1:196739084-196739106 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
919776483 1:201197427-201197449 CTGCAGCAGCGGCAGCAGCCTGG - Intronic
919787425 1:201268705-201268727 CAGCAGCAGCTGCTGCAGGGAGG + Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
920034453 1:203056811-203056833 CAGCAGCAGCAACAGCAGCCAGG + Exonic
920178225 1:204116662-204116684 CGGCAGCAGCAGGAGCAGGTAGG + Exonic
920335349 1:205241613-205241635 CAGCAGCATCAGCAGCAGCAGGG + Exonic
920600780 1:207321821-207321843 CAGCACCAGCAGCAGCAGCCGGG - Exonic
920662176 1:207924540-207924562 CAGCAGCAGCAGCATCACCTGGG - Intergenic
920845240 1:209588139-209588161 CAGCACCAGCAAAAGGAGGGTGG + Intronic
920968452 1:210721648-210721670 CAGAAGCCGTAGAAGGAGCGGGG + Intronic
921132687 1:212233171-212233193 CAGCAGCAGCAGCATCACCTGGG - Intergenic
921431909 1:215075889-215075911 CAGCATCAGCAGAATAACCGGGG + Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921812362 1:219529419-219529441 GAGCAGCAGCAGCAGCAGCAGGG + Intergenic
922164076 1:223100514-223100536 CAGCCACAGCTGAAGCAGCTGGG - Intergenic
922167434 1:223127897-223127919 AAGCAGCAGCAGCAGCACCTGGG + Intronic
922190141 1:223311407-223311429 CAGCAGCAGCACAGGCTGCCTGG - Intronic
922534295 1:226368410-226368432 CAGCAGGTCCAGAAGTAGCGTGG + Intronic
922625636 1:227038740-227038762 CAGCAGCAGGAGATGCAACATGG + Intronic
922872322 1:228912842-228912864 CAGCAGCAGCAGCAGCTATGTGG - Intergenic
922969621 1:229725120-229725142 CAGCCGCAGCAGCAGCATCTGGG - Intergenic
923119712 1:230978802-230978824 CAGCAGCAGCAGCAGCCGGCAGG + Exonic
923256583 1:232226640-232226662 CAGCAACAGCAGCAGCAGCCTGG + Intergenic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
923530328 1:234807182-234807204 CAGAAGCAGCAGGAGGGGCGTGG - Intergenic
924030296 1:239879315-239879337 CAGCAGCAGCAGAATCTCCTGGG - Intronic
924052523 1:240092770-240092792 CAGCAGCAGCAGCAGCTCCAGGG + Exonic
924426419 1:243954458-243954480 AAGCAGCAGCAGTAACAACGTGG - Intergenic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924567401 1:245210192-245210214 CAGCAGAAGCTGCAGCTGCGGGG - Intronic
924624259 1:245686673-245686695 CATCATCAGCAGCATCAGCGAGG + Exonic
924705686 1:246500074-246500096 AAGGAGCAGCAGCAGCAGCAGGG - Intronic
924706285 1:246505432-246505454 CAGCAGCAGCAGCAGCACCAGGG + Intronic
1063308612 10:4931648-4931670 CAGCAGCAGCAGAACCTCTGTGG + Intronic
1063318059 10:5025824-5025846 CAGCAGCAGCAGAACCTCTGTGG - Intronic
1063349875 10:5344223-5344245 CAGTAGCAGCAGCAGCTGCTTGG - Intergenic
1063652217 10:7949015-7949037 CAGCAGCGGCGGCAGCAGCCGGG - Intronic
1063819755 10:9820317-9820339 CAGCAGCAGCAGGAGCTTGGTGG - Intergenic
1063957579 10:11280946-11280968 CGCCAGCATCAGAAGCAGCCAGG - Intronic
1064322904 10:14322230-14322252 CTGAGGCAGCAGAAGCAGCATGG + Intronic
1064408948 10:15088740-15088762 CAACAGCAGCAGCAACAACGCGG - Exonic
1064419569 10:15179261-15179283 CAGCAGCAGCAGTATCTGTGAGG - Intergenic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1066048282 10:31613311-31613333 CAGCAGCAACAGCAACAGCAGGG - Intergenic
1066224090 10:33365491-33365513 CGTCAGTAGCAGAAGCAGAGAGG + Intergenic
1066959543 10:42207880-42207902 GAGCAGCAGCAGGAGCTGCCAGG - Intergenic
1067024881 10:42836250-42836272 CAGCCTCAGAAGGAGCAGCGAGG - Intergenic
1067370539 10:45678297-45678319 CAGCAGCATCATAAGCCGCAGGG + Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067724481 10:48759539-48759561 CAGCAACAGCAGCAGCAGCCAGG - Intronic
1068097612 10:52511645-52511667 CAGCAGCAGCAGGACCAGAGAGG + Intergenic
1068755580 10:60648853-60648875 GAGCAGGAGCAGAAGCAGCTTGG - Intronic
1069840687 10:71337540-71337562 AAGCAGCAGCAGAGGCAGCTGGG - Intronic
1069900662 10:71704994-71705016 CATCAACAGCAGCAGCGGCGTGG + Intronic
1070160772 10:73865577-73865599 CAGCAGCAGTGGCAGCAGAGGGG + Intronic
1070668401 10:78361388-78361410 CAGAAGCAGCAGTAGCACCTGGG - Intergenic
1070742898 10:78914067-78914089 CACCAGCAGCGGCAGCAGCCGGG - Intergenic
1070786319 10:79164191-79164213 CAGCACCAACAGCGGCAGCGTGG + Intronic
1070938883 10:80325297-80325319 CAGCAGTAGCAGCAGCATCTGGG + Intergenic
1070994105 10:80760649-80760671 CAGCAGCAGCAGCATCACCTGGG - Intergenic
1071086739 10:81874975-81874997 CAGCAGCAGCAGCGGGCGCGGGG + Intergenic
1071347118 10:84703343-84703365 CAGCAGAAGCAAAAGTAGCCTGG - Intergenic
1071358023 10:84817959-84817981 CAGCAGCAGCAGCAGCATGAGGG + Intergenic
1071397456 10:85237969-85237991 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1071444201 10:85730847-85730869 CAGCAGCAGCAGCATCACCTGGG - Intronic
1071813300 10:89206915-89206937 GTGCAGCAGCAGGAGCAGCTCGG + Exonic
1071882106 10:89910894-89910916 CAGCAGCAGCAGTGGCAGCATGG + Intergenic
1072047590 10:91672226-91672248 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1072189052 10:93066011-93066033 CAGTAGCAGCAGGACGAGCGAGG - Exonic
1072280581 10:93862062-93862084 CAGCTGGAGCTGAAGCAGCAGGG - Intergenic
1072336611 10:94403285-94403307 CAGCAGCTGCAGCAGTAGCGAGG + Exonic
1072562199 10:96586773-96586795 CAGCAGCAGCAGCCACAGCGCGG + Exonic
1072919200 10:99561346-99561368 CAGCAGGAAGAGAAGCAGTGGGG - Intergenic
1073101827 10:101010530-101010552 CAGCCGCAGCCGCAGCAGCCGGG - Intronic
1073249641 10:102114023-102114045 CAGCAGGAGTAGAGGCAGCAAGG + Intronic
1073513450 10:104057049-104057071 CAGCTGCAGCAGGAGCCGCAGGG + Exonic
1073810990 10:107152066-107152088 CAGCTGGAGCTGAAGCAGCTGGG - Intronic
1074058186 10:109941710-109941732 CAGCCGTAGCAGAAGCACCTGGG + Intronic
1074411658 10:113234034-113234056 CACCAGGAGCAGAGGCAGCCAGG - Intergenic
1074944892 10:118271761-118271783 CTGCCTCAGCAGAAGCAGCAGGG - Intergenic
1075438470 10:122461669-122461691 CAGCAGCAGCGGGAGAAGAGCGG - Exonic
1075486884 10:122829650-122829672 AAGCAGCTGCAGCAGCAGCAGGG - Intergenic
1075534432 10:123258116-123258138 CAGCTGGAGCAGCAGCGGCGAGG - Intergenic
1076136313 10:128047426-128047448 CAGCAGCGGCAGTAGCAGCCAGG - Exonic
1076140872 10:128077734-128077756 CAGAAGCAGCAGCAGCAGACAGG + Exonic
1076169599 10:128308304-128308326 CAGCTGCAGCTGGAGCAGCGGGG - Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076406479 10:130215490-130215512 CAGCACCATCAGAAGCAGCCTGG + Intergenic
1076613945 10:131744001-131744023 CTGCAGCTGGAGAAGCAACGGGG - Intergenic
1076758402 10:132587362-132587384 TGGCAGCAGCAGAAGCAGGCTGG - Intronic
1076825246 10:132963897-132963919 CACCAGAAGCAGAAGCGCCGAGG - Intergenic
1077063347 11:627108-627130 GAGCAGCAGCAGCAGCAGGAGGG + Exonic
1077063350 11:627114-627136 CAGCAGCAGCAGGAGGGGCCGGG + Exonic
1077103310 11:831635-831657 CAACAGCAGCAGCAGCAGGTGGG - Exonic
1077250547 11:1558822-1558844 CAGGAGCTCCAGAAGCAGCTTGG - Intronic
1077370013 11:2177445-2177467 CAGCAGCAGTAGCAGAAGGGGGG - Intergenic
1077976914 11:7256292-7256314 CAGCAGCAGCAGCAGCTGCTGGG + Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078467514 11:11561154-11561176 CAGCAGCAGCAGAAACTGCGAGG + Intronic
1078544571 11:12237748-12237770 CAGGAGCAGCAGCAGCAGCTGGG + Intronic
1078721597 11:13889662-13889684 GAGCAGCAGCAATAGCAACGGGG + Intergenic
1079128435 11:17734591-17734613 CGGGAGCAGCAGGAGCCGCGCGG + Intergenic
1079181380 11:18196747-18196769 CAGCAGCAGCAGTACCAGATAGG - Intronic
1079253088 11:18802023-18802045 GAGCAGCAACAGAAGCTGCCTGG + Intergenic
1080105231 11:28504681-28504703 CTACAGCAGCAGAGCCAGCGTGG + Intergenic
1080229452 11:30002488-30002510 CAGCAGCAGCTAAATCAGCAAGG + Intergenic
1080540201 11:33257672-33257694 CAGCAGCAGCAGCAGCGGTCGGG + Exonic
1080606647 11:33869671-33869693 CAGCAGCAGCTGCAGCCGCCTGG - Intronic
1080798969 11:35591624-35591646 CAGAAGCAACAGCAGCAGCATGG - Intergenic
1080856365 11:36115172-36115194 CAGCAGTGGCTGAAGCAGCCAGG - Intronic
1081165975 11:39809813-39809835 GAGCACAAGCAGAAGCAGGGTGG + Intergenic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1082004553 11:47412363-47412385 CTGCAGCAGCAGCAACAGCTGGG + Exonic
1082176511 11:49066254-49066276 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1082883253 11:58058754-58058776 CAGCAGCTGCAGAAGCAGATCGG - Intronic
1083299699 11:61733952-61733974 CAGCAGCACCTGAGACAGCGTGG - Intronic
1083393284 11:62371277-62371299 CAGCAGCAGCAGCGGCGACGAGG + Intronic
1083436597 11:62647434-62647456 CAGCAGCCCCCGAAGCAGCACGG + Exonic
1083490043 11:63009318-63009340 CAGCTGCTGGAGAAGCAGAGAGG - Intronic
1083607256 11:63986478-63986500 CAGCAGAAGCAGGAGCCGCTGGG + Exonic
1083668466 11:64287750-64287772 CACCAGCAGAAAGAGCAGCGAGG - Exonic
1083729065 11:64643300-64643322 CGGCAGCGGCAGCAGCGGCGCGG - Intronic
1083796879 11:65021967-65021989 CAGCAGTAGCAGCAGCAGGCTGG - Exonic
1083829137 11:65219923-65219945 TGGCAGCAGCAGAGGCAGTGAGG + Intergenic
1083851310 11:65369040-65369062 CAGCAGCAGCAGCAGCATCTGGG + Intergenic
1083853964 11:65383070-65383092 CAGCAGCATCAGCGGCAGCCTGG + Intronic
1084086581 11:66857749-66857771 CAGCAGCAGCAGGAGCGGCGGGG - Exonic
1084164712 11:67370194-67370216 CAGCAGGAGGGAAAGCAGCGTGG + Intronic
1084284203 11:68121118-68121140 CAGCAGCAGCCCGAGCGGCGAGG + Exonic
1084650614 11:70487145-70487167 CAGCAGCGGCAAGAGCAGCCAGG - Intronic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084738220 11:71119792-71119814 CGGCAGCAGCAGTAGCACCTTGG - Intronic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1084860436 11:72014504-72014526 GGGCAGCAGCAGGAGGAGCGTGG - Exonic
1084954853 11:72685737-72685759 CAGCTGCAGCAGCTTCAGCGGGG - Intronic
1085022244 11:73217224-73217246 CACCAGGAGCAGTAGCAGAGTGG - Intergenic
1085305661 11:75484337-75484359 CAGCAGCAGCTGCACCAGAGGGG + Intronic
1085808426 11:79658078-79658100 CAGAAGCATCAGCATCAGCGGGG + Intergenic
1085814876 11:79727313-79727335 GAGAAGCAGCAGTGGCAGCGCGG + Intergenic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1086689202 11:89769621-89769643 CAGGAGCAGCAGAAGCTGTAAGG + Intergenic
1086716656 11:90070350-90070372 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087133852 11:94694660-94694682 CAGCTGGAGCAGCAGCAGCACGG + Intergenic
1087144649 11:94799803-94799825 CAGCAGCAGCAACAGCAGCAGGG + Exonic
1087321178 11:96660703-96660725 CAGCAGGAGCTGAAGGAGCTTGG - Intergenic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087915148 11:103801075-103801097 CAGCAGCAGCAATAACAACGTGG - Intergenic
1088034697 11:105296972-105296994 GAGCAGGAGTAGAAGCAGGGTGG - Intergenic
1088172837 11:107017848-107017870 CGGCGGCGGCAGAAGCAGCCGGG + Exonic
1089252118 11:117172004-117172026 CAGCAGCAGTGAAAGCAGCCTGG + Intronic
1089278517 11:117356011-117356033 CAGCAGCAGCAACAGCAACCTGG + Intronic
1089340564 11:117754581-117754603 CACCACCAGCAGAAGAAGCAAGG + Intronic
1089572440 11:119419453-119419475 CAGGAGCAGCAGCAGCCACGAGG + Exonic
1089609457 11:119661355-119661377 CAGCAGTGGCAGCAGCAGAGGGG + Exonic
1089922662 11:122225026-122225048 CAGCAGCAGTAGAAGTAACAAGG + Intergenic
1090476987 11:127032017-127032039 CAGCAGCAGCAGCAACACCCGGG - Intergenic
1090676126 11:128998384-128998406 AAACAGAAGCTGAAGCAGCGGGG - Exonic
1090914832 11:131154240-131154262 CAGCGGCACCAGCAGCACCGGGG - Intergenic
1090931129 11:131299069-131299091 CAGCAGCAGCAGCACCACCTGGG - Intergenic
1091105336 11:132913898-132913920 GAGCTGCAGCAGAGGCAGAGAGG - Intronic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091111353 11:132971930-132971952 CGGCAGCAGCAGTAGCAGCAGGG - Intronic
1091255288 11:134178828-134178850 CAGCATCAGCAGACGAAGCCAGG + Exonic
1091271180 11:134312978-134313000 GAGCAGCAGCACCAGCAGCAGGG - Intronic
1091293232 11:134454106-134454128 CAGCAGCAGCAGCAGAAGCAGGG - Intergenic
1091333981 11:134753080-134753102 CAGCAGCAGCAGAGGCCCCACGG + Intergenic
1091594335 12:1865655-1865677 CAGCAGCAGCAGCAGCACCAGGG + Intronic
1091594338 12:1865664-1865686 CAGCAGCACCAGGGGCAGCCGGG + Intronic
1091850398 12:3692641-3692663 CAGCAGCAGTGGCAGCAGCATGG + Intronic
1092257794 12:6936759-6936781 CAGCAGCAGCAGCAGCATCACGG + Exonic
1092444368 12:8540181-8540203 CAGCAGCAGCAGTAGCCCCTGGG - Intronic
1093038121 12:14352172-14352194 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1093073477 12:14732152-14732174 CACCAGCAGCAAAAGCTGAGTGG - Intergenic
1093112389 12:15167388-15167410 CAGCATCAGCAGAATCACCTGGG + Intronic
1094166252 12:27446870-27446892 CAGCATCAGCAAAAGCATCAGGG - Intergenic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1094501977 12:31029697-31029719 CAGCAGCAGCAGGATCACCTGGG - Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1095879224 12:47114602-47114624 AAGCAGTAGCAGAAGTAGTGGGG - Intronic
1095981364 12:47976531-47976553 CAGCAGGACCAGAAGCACCTTGG + Exonic
1096111728 12:49032778-49032800 CAGCAGCAACAGCAGCAGATGGG - Exonic
1096112854 12:49039519-49039541 CAGCAGCTGCAGGAGCAGTGGGG - Exonic
1096154908 12:49336457-49336479 CACCAGCAGCAGCAGCACCATGG + Exonic
1096180698 12:49548986-49549008 CAACTGCAGCAGCAGCAGCGAGG + Exonic
1096476832 12:51913678-51913700 CGGAGGCAGGAGAAGCAGCGTGG + Exonic
1096848162 12:54419109-54419131 CAACAGCAGCGGCAGCAGCGGGG + Exonic
1097053069 12:56235211-56235233 CAGGAGCCGCAGCAGCAGCAGGG - Exonic
1097173274 12:57128972-57128994 CAGCAGCAGGAGCAACGGCGGGG - Exonic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1097554040 12:61115413-61115435 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1097585481 12:61510695-61510717 CAGCAGCAGCAGGAGAAGAATGG + Intergenic
1097708715 12:62895455-62895477 CAACAGCAGCAGCAGCACCTGGG + Intronic
1097909023 12:64949271-64949293 CAGCAGCAGCAGCAGCCACATGG - Intergenic
1098893277 12:76031125-76031147 CAGCAGCAGCAACAACAGCCCGG - Exonic
1099390181 12:82070046-82070068 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1100089630 12:90954375-90954397 GAGCAGCAGCAAAAGCAGAGAGG + Exonic
1100243456 12:92732963-92732985 CACGACCAGCAGCAGCAGCGGGG + Intronic
1100415543 12:94369884-94369906 AAGCAGCAGCAGCAGCAGCAAGG + Intronic
1100446343 12:94663852-94663874 CAGCACAAGCAGAGGCAGAGAGG - Intergenic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1101759191 12:107645291-107645313 GAGCAGCAGCAGAAGCACCTGGG - Intronic
1101907599 12:108839373-108839395 CAGCTGCAACAGACACAGCGTGG + Intronic
1102329009 12:112013500-112013522 CAGGAGAAGGGGAAGCAGCGGGG - Exonic
1102347204 12:112167844-112167866 CAGCAGCAGCAGCGACAGCGAGG + Exonic
1102471322 12:113161475-113161497 CAGCCGCAGCTGAAGCTGCTCGG + Intronic
1102487154 12:113266283-113266305 CAGCAGCAGCAGCAGGGCCGTGG - Exonic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1102965029 12:117119130-117119152 CAGCAGCAGCAGCAGCTTGGAGG - Intergenic
1102997705 12:117362432-117362454 GAGCAGCAGCAACAGCAACGGGG - Intronic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103209548 12:119156573-119156595 CAGCAGCAGCAGTAGCCGCTCGG + Exonic
1103300963 12:119926424-119926446 TAGCAGCAGCAGCAGCACCCAGG + Intergenic
1103725701 12:122996469-122996491 CAGCAGCCGCCGGGGCAGCGTGG - Exonic
1103908678 12:124340172-124340194 GAGCAGCGGCAGCAGCGGCGGGG - Exonic
1103956855 12:124582220-124582242 CAGCAGCAGCAGCACCAGCCTGG - Intergenic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104604775 12:130179878-130179900 CCGCAGCAGCTGAAGCTGCAGGG - Intergenic
1104641765 12:130471710-130471732 CAGGAGCAGCAGGAGCATCTGGG - Intronic
1104642008 12:130473416-130473438 CAGGAGCAGCAGCAGCATCTGGG + Intronic
1104846840 12:131851201-131851223 CGGCAGCAGCAGCAGCATGGTGG - Exonic
1104857778 12:131909939-131909961 CAGGAGCAGCTGCCGCAGCGGGG - Exonic
1104866960 12:131961451-131961473 CAGCAGCAGCAGGTGCTGCAGGG + Exonic
1104885509 12:132104819-132104841 CAGCAGCAGCAGGTGCTGCAGGG + Exonic
1105303711 13:19155305-19155327 CAGCAGCTGCGGAAGCTGCAAGG + Intergenic
1105306440 13:19172383-19172405 CAGCAGTGGCAGCAGCAGCAGGG - Intergenic
1105602588 13:21900500-21900522 CAGCAGCAGAAGCACCAGCCTGG + Intergenic
1106005308 13:25764538-25764560 AAGCAGCAGCGGCAGCAGCCGGG + Intronic
1106038720 13:26069414-26069436 CAGCAGGATCAGAATCAGAGAGG - Intergenic
1106109287 13:26762187-26762209 CAGCAGCAGCAGCATCACTGGGG - Intergenic
1106250162 13:27976917-27976939 CAGCAGCAGCAACAGCAGCAAGG - Intergenic
1106478359 13:30117158-30117180 CAACAGCAGCAGCAGCACCTGGG + Intergenic
1106701877 13:32237861-32237883 CAGCAGCAGCTGCTGCAGCCCGG - Exonic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107404432 13:40099312-40099334 CAGCAGCAACAGCAGCAGTTTGG + Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1107826439 13:44332727-44332749 AGGCAGCAGCAGCAGCAGGGAGG - Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1107991248 13:45820706-45820728 CAGAAACTGCAGAAGCAGCCAGG - Intronic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1108695639 13:52900201-52900223 CAGCAGCAGCAGCATCACCTGGG + Intergenic
1108727582 13:53200039-53200061 CAGCAGCCACAGAATCAGCAAGG - Intergenic
1108882782 13:55141763-55141785 CAGCAGCAGCAGTATCACCTAGG - Intergenic
1109495633 13:63168154-63168176 CAGCAGCAGCAGCAGCATCAGGG + Intergenic
1110166364 13:72448085-72448107 CAGCTGAAGCTGAAGCAGCTGGG - Intergenic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1110630146 13:77698077-77698099 CAGCAGCAGCAGGTGCGGGGCGG - Intronic
1110630147 13:77698080-77698102 CGGCAGCAGCAGCAGGTGCGGGG - Intronic
1111735590 13:92135050-92135072 CTGCAGCAGGAGAACCAGAGAGG - Intronic
1112200338 13:97268425-97268447 CAGCAGCAGCAGCATCCGCTGGG - Intronic
1112394464 13:99016032-99016054 CAGCAGCATCTGCAGCAGTGTGG - Intronic
1112504908 13:99969780-99969802 CAGCAGCAGCTGGAGCAGGAAGG - Intronic
1112558479 13:100491051-100491073 CAGCAGCAGCAGCAGCATTCAGG - Intronic
1113094199 13:106646460-106646482 CCTCAGCAGCAGATGCAGAGAGG + Intergenic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113462461 13:110491707-110491729 AAGCAGCAGCAGCAACAGCGTGG - Intronic
1113568435 13:111335859-111335881 AAGCAGCGGCAGTAGCAGCTTGG - Intronic
1113831271 13:113297463-113297485 CAACAGCAGTAGCAGCAGCAGGG - Exonic
1113949496 13:114064205-114064227 CTGCAGGAGCAGAGGCTGCGAGG + Intronic
1114261896 14:21043021-21043043 CAGCAGCAGAAGCAGCAGAAGGG - Exonic
1114407053 14:22466780-22466802 CAACAGCAGCACCTGCAGCGTGG + Intergenic
1114454416 14:22845924-22845946 CACCAGGAGCAGCAGCAGCACGG - Exonic
1114519007 14:23321483-23321505 CGGCGGCGGCAGCAGCAGCGGGG + Exonic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1114976121 14:28102143-28102165 CACCAGCTGCAGAAGCAGGATGG - Intergenic
1115058561 14:29162304-29162326 CAGCAGCAGCACCAGCAGAAGGG - Intergenic
1115424615 14:33243517-33243539 CAGCAGCAGCAGTATCACCTGGG - Intronic
1115531165 14:34328500-34328522 CAGCAGAAGGAGCAGCAGCTGGG + Intronic
1115708858 14:36028022-36028044 CAGCAAGAGTAGAAGCAGCAGGG - Intergenic
1116098927 14:40408545-40408567 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1116238252 14:42308984-42309006 CAGCAGTTGCAAAAGCAGAGGGG - Intergenic
1116441785 14:44962438-44962460 GGGCGGCAGCAGAAGCAGCGCGG - Exonic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1116931367 14:50694382-50694404 CAGCCACAGCAGGAGCAGCTGGG + Intergenic
1117072488 14:52069228-52069250 CAGCGGCCGCTGGAGCAGCGGGG + Intronic
1117082995 14:52170695-52170717 CAGCAGTTGCAAAAGCAGAGGGG + Intergenic
1117512868 14:56471140-56471162 CAGCAGTGGCAGTAGCAGTGGGG + Intergenic
1117638825 14:57775300-57775322 CAGCAGTGGCAGCAGCAGTGTGG - Intronic
1117835587 14:59802274-59802296 CAGCAGCACCAGCATCAGCTGGG + Intronic
1118059176 14:62116959-62116981 CAGCGGCTGAGGAAGCAGCGGGG - Intergenic
1118678292 14:68212431-68212453 CAACAGCAGCACCAGCAGCAAGG + Intronic
1118749316 14:68794955-68794977 GGGCAGCAGCAGAACAAGCGAGG - Intronic
1118796172 14:69147368-69147390 CAGCAGCAGTAGCAACAGCATGG + Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119573753 14:75699685-75699707 GAGAAGCAGCAGCAGTAGCGAGG - Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119777305 14:77257126-77257148 GAGCAGCAGCAGAAGCTCCTTGG - Exonic
1120185876 14:81393417-81393439 CAGCAGCAGCAGGAAGAGTGAGG + Intronic
1121038360 14:90725334-90725356 CAACAGCAGCAGCAGCAGACAGG - Intronic
1121070340 14:91013742-91013764 GACCAGCAGCAGCAGCAGCGTGG + Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121201586 14:92122239-92122261 CAGTCGCAGCCGAAGCGGCGGGG - Intronic
1121223852 14:92306949-92306971 CAGCAGCAGCAGCATCACCTAGG - Intergenic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121308410 14:92922005-92922027 CAGCAGCCGCAGATGGAGAGGGG + Intergenic
1121711050 14:96039452-96039474 CAGCGGCAGCGGCAGCAGCGAGG + Exonic
1122608774 14:102966746-102966768 AAGCGGCTGCAGAAGCAGCAGGG - Intronic
1122723676 14:103736387-103736409 CGGCAGCAGGAGCAGCAGCTGGG - Intronic
1122738696 14:103858482-103858504 CAGCAGCATCAGCAGCACAGGGG - Intergenic
1122975269 14:105168370-105168392 CAGCAGCAGCAGCAGCCGCCGGG + Exonic
1123020018 14:105393314-105393336 CAGCAGCAGAACATGCTGCGGGG + Exonic
1202933381 14_KI270725v1_random:60834-60856 GAGCAGCAGCAGGAGCTGCCAGG + Intergenic
1123498053 15:20850180-20850202 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1123555284 15:21423808-21423830 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1123591529 15:21861139-21861161 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1123721375 15:23064553-23064575 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
1123761285 15:23434800-23434822 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1124179028 15:27456086-27456108 CTGCAGGACCAGAAGCAGTGCGG - Intronic
1124268009 15:28254728-28254750 GAGCATCAGCAGAGGCAGCCTGG - Intronic
1124277222 15:28336194-28336216 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1124305479 15:28575412-28575434 GAGCATCAGCAGAGGCAGCCTGG - Intergenic
1124417878 15:29489192-29489214 AGGCAGTAGCAGAAGCAGCATGG + Intronic
1124929124 15:34101789-34101811 TAGCAGCAGCAGCAGCAGGACGG + Exonic
1125200759 15:37099092-37099114 CAGCGGCAGCAGGAGAACCGGGG + Intronic
1125610184 15:40964321-40964343 CAGCTGCAGCCCAAGCAACGTGG + Intergenic
1125703624 15:41711188-41711210 CAGCAGCAGCAACAGCAACAGGG + Exonic
1125768408 15:42149960-42149982 CACCAGCACCAGAACCAGGGAGG + Intronic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1125882160 15:43204324-43204346 CAGCAGCAGCAGCAGCATTTAGG - Intronic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126356587 15:47802431-47802453 CAGCAGCAGCAGAGTCATCAGGG - Intergenic
1126580672 15:50239844-50239866 CAGCAGCATCAGCAGCACCTGGG + Intergenic
1126800715 15:52295011-52295033 CATCAGAAGCTGAAGCAGCCTGG - Intronic
1127215501 15:56819395-56819417 AAGCAGCAGCAGGAGCAACAGGG - Intronic
1127428580 15:58880435-58880457 CAGCAGCAGCAGCACCAGCTGGG + Intronic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1127903307 15:63357331-63357353 CAGCAGCAGCAGCATCACCTGGG - Intronic
1128153505 15:65377714-65377736 CAGCAGCGGCAGCAGGAGCCGGG + Exonic
1128338533 15:66803677-66803699 CAGCAGCATCAGCAGCACCTGGG + Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128830435 15:70763481-70763503 CGGCTGCAGCAGAGGCGGCGCGG + Exonic
1129466783 15:75728563-75728585 CAGCAGCAGCAAAGCCAGAGCGG - Intergenic
1129538952 15:76335996-76336018 CAGCAGCGGCAGCAGCAGCAAGG + Intergenic
1129607095 15:77030314-77030336 GAGCAGCAGCAGCACCAGCGTGG + Intronic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1129789017 15:78328429-78328451 CAGCAGCATCAGAATCACCTGGG - Intergenic
1129839472 15:78734873-78734895 CAGGAGCAGCAGAAGAGGCTGGG + Intergenic
1129919912 15:79311275-79311297 CAGCAGCAGAAGCAGCACGGAGG - Exonic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1129977706 15:79836257-79836279 AAGCAGCAGCAGCAGCACCCAGG + Intronic
1130156777 15:81357396-81357418 AAGCAGCAGATGAACCAGCGTGG + Intronic
1130881753 15:88061526-88061548 GAGCAGGAGCAGGAGCAGAGTGG + Intronic
1130911880 15:88276436-88276458 CAGCAGCAGCAATAGCACCTGGG - Intergenic
1131139347 15:89964439-89964461 CAGCAGCAGCAGGATCAGTCAGG - Intergenic
1131466054 15:92655615-92655637 CAGCAGCAGCGGCAGGAGCGGGG + Exonic
1131466055 15:92655618-92655640 CAGCAGCGGCAGGAGCGGGGCGG + Exonic
1131478438 15:92761692-92761714 CAGTAGCAGCAGAAGCCTAGTGG + Intronic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132026094 15:98405537-98405559 GAGCAGCAGCAACAGCAGCCTGG - Intergenic
1132199737 15:99943275-99943297 CACGAGCAGCTGCAGCAGCGTGG + Intergenic
1132394498 15:101462943-101462965 CAGCAGCCCCAGGAGCAGCCTGG + Intronic
1132394692 15:101464148-101464170 CAGCAGCCCCAGGAGCAGCCTGG - Intronic
1202963630 15_KI270727v1_random:151017-151039 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1132529776 16:440790-440812 CAGCTGCAGCTGAACCAGCAGGG - Intronic
1132681309 16:1143190-1143212 TAGCAGCAGCAGTGGCAGTGAGG - Intergenic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1132953078 16:2575729-2575751 GAACAGCAGCAGCAGCAGCGAGG + Intronic
1132961273 16:2624439-2624461 GAACAGCAGCAGCAGCAGCGAGG - Intergenic
1132999455 16:2841690-2841712 CCACAGCAGCAGAAGCAGGATGG + Intergenic
1133042869 16:3069751-3069773 TGGCAGCAGGAGAAGCAGGGTGG + Intronic
1133129212 16:3665842-3665864 TGGCAGCAGCAGCAGCAGCCAGG + Intronic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133268705 16:4600172-4600194 CAGCAGCAGCAGAGGTGGCAGGG - Exonic
1133288281 16:4701487-4701509 CCAGAGCAGCAGCAGCAGCGAGG - Exonic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133456839 16:5949729-5949751 CAGCAGCAGCAGCATCAACTAGG + Intergenic
1133845491 16:9449667-9449689 CAGTAGCTGCAGCAGCAGCAGGG + Intergenic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1134190219 16:12115197-12115219 CAGCAGCAGTGAAAGCAGCGAGG - Intronic
1134761522 16:16718951-16718973 CAGCAGCATCAGCACCAGCCTGG + Intergenic
1134984536 16:18640219-18640241 CAGCAGCATCAGCACCAGCCTGG - Intergenic
1135189272 16:20341592-20341614 CAGCAGCATCAGCAGCATCCAGG - Intronic
1135732708 16:24907959-24907981 CAGCAGCAGCACAAACACCCTGG - Exonic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1135994516 16:27238121-27238143 CAGCAGCAACAGAGGTGGCGTGG + Intronic
1136019337 16:27430091-27430113 GAGCAGCAGCAGGAGCAAGGGGG - Exonic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136550464 16:30979920-30979942 CAGCAGCAGCAGCAGCGATGGGG + Exonic
1136777214 16:32878466-32878488 CAGAAGCAGCAGTGGCAGCTTGG - Intergenic
1136858733 16:33681815-33681837 CAGCATCAGAAGGAGCAGCAAGG + Intergenic
1136893409 16:33983047-33983069 CAGAAGCAGCAGTGGCAGCTTGG + Intergenic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137593887 16:49710952-49710974 CAGCTGCACCAGAAGCTGCCGGG + Intronic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137673936 16:50294569-50294591 CAGCAGCAGCAGGAGCACGCAGG - Intronic
1137775014 16:51047213-51047235 CAGAAGCAGCAGCAGCAGCTGGG + Intergenic
1137829217 16:51527611-51527633 CATCAACAGCAGTAGCAACGTGG - Intergenic
1138166654 16:54808118-54808140 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
1138360768 16:56425499-56425521 GGGCAGCAGCGGGAGCAGCGCGG - Exonic
1138420987 16:56898941-56898963 CAGCCGAATCAGAATCAGCGTGG + Intronic
1138461587 16:57151546-57151568 GAGGAGCAGCAGAAACAGTGGGG + Intergenic
1139099189 16:63744640-63744662 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139309646 16:66017786-66017808 CAGCTTCAGCAGAAGTAACGTGG + Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139389895 16:66600759-66600781 CAGCAGCAGCAGAAAAAGCTGGG + Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139447462 16:67006669-67006691 CAGAAGCAGCAGGAGTAGGGTGG + Intronic
1139459410 16:67109967-67109989 CTGCAGCAGCCGCGGCAGCGGGG - Exonic
1139476219 16:67203762-67203784 CAGCTCCAGCAGACGCAGCTTGG - Exonic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1139937239 16:70580115-70580137 AAGCAGCAGCAGAATCGGGGTGG - Intronic
1139968277 16:70757655-70757677 CTGCTGAAGCAGAAGCAGGGAGG + Intronic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140851162 16:78935932-78935954 AAGCAGCAGCAGCAGCAGCTAGG + Intronic
1140870957 16:79106081-79106103 CAGCAGCATCAGAATCACCTGGG + Intronic
1140894226 16:79310991-79311013 AAGCAGCCGCAGCAGCAGCCAGG - Intergenic
1141062999 16:80892244-80892266 CAGCAGCAGCAGCCGCACCTGGG + Intergenic
1141071138 16:80955324-80955346 CAGCAGCAGCAGCAGCGTAGTGG - Intergenic
1141125397 16:81397424-81397446 CAGCAGCTCCAGAAGCTGCAAGG + Intergenic
1141128311 16:81416953-81416975 CGGCAGCAGCAGCAGCAGCTAGG + Intergenic
1141141179 16:81497796-81497818 CAGCAGCAGAGGAGGCGGCGGGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141173994 16:81707566-81707588 GAGCAGGAGTAGAAGCAGGGAGG + Intronic
1141627574 16:85269321-85269343 CAGCAGCATCAGAGGCAGGCTGG + Intergenic
1141818570 16:86429780-86429802 TGGCAGCAACAGAAGCAGGGAGG - Intergenic
1141894208 16:86948170-86948192 GAGCAGGAGCAGGAGCAGAGTGG - Intergenic
1141915499 16:87093896-87093918 CAGCCGCAGCAGCCGCAGGGAGG + Intronic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142023217 16:87797169-87797191 CAGCAGCATCAGGAGCACTGTGG + Intergenic
1203079628 16_KI270728v1_random:1140575-1140597 CAGAAGCAGCAGTGGCAGCTTGG - Intergenic
1203120307 16_KI270728v1_random:1530308-1530330 CAGCATCAGAAGGAGCAGCAAGG + Intergenic
1142642479 17:1292444-1292466 GAGCAGCACCAGAAGGAGGGTGG - Intronic
1143027950 17:3951974-3951996 GACCAGCAGCAGCAGCAGCTGGG + Intronic
1143147538 17:4786311-4786333 CAGCAGCAGCGGCAGCAGCTTGG + Exonic
1143471152 17:7177049-7177071 CAGCTGCAGGAGGAGCTGCGGGG - Exonic
1143550953 17:7630198-7630220 CAGCAACAGCAGCAGGCGCGAGG - Exonic
1143897372 17:10146480-10146502 CAGCAGCACCAGAATCACCTGGG + Intronic
1143946002 17:10592620-10592642 CAGCAGCATCAGCACCAGCTGGG + Intergenic
1143964522 17:10747482-10747504 AAGCAGCAGCAGAGGGAGCGAGG - Intergenic
1144630701 17:16870756-16870778 CATCAGCAGCAGCAGCCCCGGGG + Intergenic
1144733404 17:17541472-17541494 CACCGGCCGCAGCAGCAGCGGGG + Intronic
1145991125 17:29080102-29080124 CATCAGCAGCAGAGGCGGAGCGG + Intronic
1146354880 17:32125538-32125560 CAGGTGCTGCAGAAGCAGCAGGG - Intergenic
1146718109 17:35103328-35103350 CAGGAGGAGGAGAAGCAGAGAGG + Intronic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147262789 17:39218271-39218293 CAGCAGCAGCAGCAGCGTGGGGG + Intronic
1147327358 17:39675878-39675900 CAAGAGGAGCAGAAGCAGCAAGG - Intronic
1147428179 17:40356187-40356209 CAGCTCCAACAGAAGCAGCCCGG + Exonic
1147672461 17:42184493-42184515 CAGCAGCAGCAGTAGCGTCACGG + Exonic
1147879402 17:43644238-43644260 CAGCAGCATCAGTAGCACCAGGG + Intronic
1147964788 17:44188715-44188737 CAACAGTAGCAGCAGCAGCAAGG + Intronic
1148021692 17:44557711-44557733 CAGCAGCGGCAGCAGCAGGCGGG - Exonic
1148476900 17:47934720-47934742 AAGCAGCATCAGAATCAGAGTGG + Intergenic
1148612133 17:48971601-48971623 CAGAAGCAGCAGAATATGCGAGG + Intergenic
1148647168 17:49225714-49225736 GGGCAGCAGGAGAAGCAGTGGGG + Intronic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149072185 17:52556371-52556393 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1149092542 17:52801464-52801486 CAGCAGTAGCAGTAGCAGATTGG - Intergenic
1149599707 17:57885522-57885544 GAGCAGCAGCGGCAGCGGCGGGG - Exonic
1149601968 17:57898990-57899012 CAGCAGGAGCACAGGCAGAGTGG + Intronic
1149634694 17:58157219-58157241 CAGCAGCAGTAGCCGCAGGGTGG - Intergenic
1149634695 17:58157222-58157244 CGGCAGCAGCAGTAGCCGCAGGG - Intergenic
1150163994 17:62924117-62924139 CCACAGGAGCAGAAGCAGAGGGG - Intergenic
1150311086 17:64130000-64130022 CAGCAGCAGCAGCAGCCGCCGGG + Exonic
1150318310 17:64188335-64188357 CAGCAGCAGCAAAGGCAGTGTGG - Exonic
1150484123 17:65532421-65532443 AAGCAGCAGCAGCAGCAGCCAGG + Intronic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151306770 17:73267663-73267685 CAGCAGCACCTGAAGCATCATGG - Intergenic
1151980021 17:77503164-77503186 CAGAGGCAGGAGAAGCGGCGGGG - Intergenic
1152068639 17:78124614-78124636 CACCAGCAGCAGCAGCAGGAGGG + Exonic
1152207532 17:78982295-78982317 CAGCAGTGGCAGAAGCTGAGAGG - Intergenic
1152330268 17:79668756-79668778 CAGCAGGAGCAAGAGCAGCTTGG - Intergenic
1152415828 17:80161167-80161189 GAGGAGCAGCAGCAGCAGCAGGG + Intergenic
1152419407 17:80184023-80184045 CAGCAGCTGCAGGAGCACCTGGG + Exonic
1152651377 17:81495056-81495078 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152681868 17:81672633-81672655 CAGCGGCAGCAGCAGCTGCACGG + Exonic
1152698804 17:81809044-81809066 CAGCAGCAGCAACAGCAGCAGGG - Exonic
1152743283 17:82027929-82027951 CAGCAACAGTGAAAGCAGCGAGG + Intronic
1152748429 17:82051686-82051708 CAGCGGCAGTAACAGCAGCGCGG + Exonic
1152809487 17:82374842-82374864 CAGCAGCAGCGCCAGCAGCCAGG - Exonic
1153992708 18:10414424-10414446 GAGTACCAGCAGAAGCCGCGTGG - Intergenic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154184947 18:12174982-12175004 CAGCAGTAGCAGCAGCATAGTGG + Intergenic
1154299705 18:13182438-13182460 GAGCAGCCGCAGGAGCTGCGGGG - Intergenic
1154456054 18:14526609-14526631 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1154979346 18:21489715-21489737 CACCAGCAGCAGCAGCACCTGGG - Intronic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1155544781 18:26903809-26903831 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1155708603 18:28847529-28847551 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1156294067 18:35774106-35774128 CAGAAGCTGCAGCAGCAGAGGGG - Intergenic
1156666814 18:39418594-39418616 AAGAAGCAGCAGCAGCAGCAAGG + Intergenic
1156855064 18:41772293-41772315 ATGCAGCAGCAGTAGCAGCTGGG + Intergenic
1157113094 18:44839398-44839420 CAGCAGCAGCAGCAACACCCAGG - Intronic
1157400282 18:47381564-47381586 CATCAGCAGCTGAAGCAGACGGG + Intergenic
1157469129 18:47974670-47974692 CAGCAACAGCAGAAGCAAGAAGG + Intergenic
1157610075 18:48950534-48950556 CAGCAGCAGCAGCAGGGGCCCGG + Exonic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1159961105 18:74556345-74556367 CAGCAGCAGCACAGCCAGCAGGG - Exonic
1160047380 18:75399719-75399741 CAGCAGCAGCAGCAGCAAAAGGG - Intergenic
1160047733 18:75402704-75402726 CAGCAGAAGCAGAAATAGAGAGG + Intergenic
1160057681 18:75499998-75500020 CAGCAGCAGCAGCAGCATCCAGG + Intergenic
1160187784 18:76688841-76688863 CAGGAGGAGCAGAAGCAGCCGGG + Intergenic
1160240693 18:77120273-77120295 CAGCTGCACCAGATGCCGCGAGG - Intronic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1160447310 18:78937577-78937599 CGACAGCAGCAGAAGCCGGGTGG - Intergenic
1160455548 18:78996499-78996521 CAGCAGCAGAAGATGCAAAGTGG + Intronic
1160516242 18:79480662-79480684 CAGCAGCAGCAGACGCCACCCGG + Intronic
1160796025 19:945792-945814 CAGCACCAGCAGCAGGAGCCGGG - Intronic
1160846053 19:1166449-1166471 TCACAGCAGCAGAAGCCGCGTGG - Intronic
1160865096 19:1252847-1252869 CAGCAGCAGCAGCAGTGGCGTGG + Intronic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161708265 19:5832493-5832515 CAGCAGCTGAAACAGCAGCGTGG + Exonic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1162870160 19:13580438-13580460 CAGCAGCAGCAGCATCACCTAGG + Intronic
1163158753 19:15452694-15452716 GAGCAGCAGGAGCAGCTGCGGGG - Exonic
1163186259 19:15641465-15641487 CAGCAGCAGGAGCAGCCACGGGG - Exonic
1163222824 19:15934337-15934359 CAGCAGCAGAAGCAGCCACGGGG + Exonic
1163612769 19:18309704-18309726 CAGCAGCAGAAGCAGCAGAAAGG - Exonic
1163700114 19:18782667-18782689 CAGCAGCAGCTGCAGCACTGAGG + Intergenic
1164161431 19:22627828-22627850 CAGCAGCAGCAGCAGCTTGGAGG + Intergenic
1164424542 19:28129217-28129239 CAGCAGCAGGAGAAAGAGAGAGG - Intergenic
1164711662 19:30361282-30361304 CAGCAGCAGTAGCAGCATCAAGG - Intronic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165357853 19:35314928-35314950 CAGCAGCATCAGCAGCACCCAGG + Intergenic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1165452258 19:35890416-35890438 CAGCAGCAGCTGAACCAGAGTGG + Exonic
1165907808 19:39204228-39204250 CAGCAGCAGCGGGCGCAGCGGGG + Exonic
1166218853 19:41353012-41353034 CAGCGGCAGCAGCCGCAGCCCGG + Exonic
1166364856 19:42273133-42273155 CGGCAGCCGCAGCAGCAGCGTGG + Intronic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1167034030 19:46982715-46982737 CAGCAGCAGCAGCATCATCTGGG + Intronic
1167285900 19:48598901-48598923 CTGCAGTAGCAGAGGCAGTGAGG + Intronic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167436226 19:49480367-49480389 CAGCAGTAGGAGGAGCAGAGGGG - Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167498964 19:49835154-49835176 AAGCTGGAGCAGCAGCAGCGAGG + Exonic
1167581311 19:50344708-50344730 CAGAGGCAGCAGCAGCAGCAAGG + Intronic
1167584424 19:50365574-50365596 CAGAGGCAGCAGCAGCAGCAGGG + Exonic
1167604928 19:50476570-50476592 CAGCAAGAGCAGGAGCAGCCGGG - Exonic
1167617215 19:50541932-50541954 TAGCAGCAACAGCAGCAGAGTGG + Intronic
1167632256 19:50632426-50632448 CAGCAGCAGCAGTGGCCGCTGGG - Exonic
1167690577 19:50982173-50982195 CAGCAGAAGCAGGAAGAGCGGGG + Intronic
1167785216 19:51630306-51630328 CAGCAGGGGCAGCAGCAGCAGGG + Intronic
1167787315 19:51646730-51646752 CAGCAGGGGCAGCAGCAGCAGGG + Exonic
1168712892 19:58511911-58511933 GAGCAGCAGCAGCAGCAGCAAGG + Exonic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925334173 2:3080748-3080770 GAGGAGCTGCAGAAGCAGCGTGG + Intergenic
925354389 2:3227770-3227792 CAGCTGGAGCAGCAGCAGCTGGG - Intronic
925366406 2:3314960-3314982 CAGCAGCAGAAGATGCTGTGTGG - Intronic
925470290 2:4153713-4153735 AAACAGCAGCAGCAGCAGCCTGG - Intergenic
925568026 2:5277717-5277739 TAGCAGCAGGAGCAGCAGCAGGG + Intergenic
925609914 2:5693768-5693790 CAGCAGCGGCAGCAGCGGCGAGG + Exonic
925733714 2:6942483-6942505 TAGCAGTAGCAGCAGCAGCAGGG + Intronic
926021422 2:9499054-9499076 CAGCAGCAGCAGCATCACCTGGG - Intronic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926644794 2:15278002-15278024 AAGCAGCAACAGAAGCATCTGGG + Intronic
927181001 2:20446850-20446872 CCGCAGCGGCAGCAGCAGCGCGG + Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927257913 2:21056424-21056446 CAGCAGCAGCAGAATAACCCAGG + Intergenic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
928097269 2:28412379-28412401 CCGCAGAAGCAGTAGCAGCGGGG + Exonic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928593218 2:32838110-32838132 GGGCAGCAGCAGAACCAGCCTGG + Intergenic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
928865616 2:35914307-35914329 CAGCAGCAGCAGTAGCAAGAGGG - Intergenic
929026698 2:37611707-37611729 CAGCAGCATCAGCATCAGCTGGG + Intergenic
929261732 2:39873439-39873461 GAGCAGCAGCAGCGGCAGCAAGG - Intergenic
929326430 2:40616953-40616975 CAGCTGGAGCTGAAGCAGCAGGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
929604396 2:43225533-43225555 CGGCAGCAGCTGCGGCAGCGCGG - Exonic
929607053 2:43241695-43241717 CAGCAGCTGCTGGAGCAGAGCGG + Intronic
929701924 2:44169399-44169421 CGGCAGCAGGGAAAGCAGCGAGG - Intronic
929871077 2:45759860-45759882 CACCTGCAACAGAAGCAGTGAGG - Intronic
930092583 2:47541987-47542009 CAGCAGCAGCAGCGGCAGCAGGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930096430 2:47570258-47570280 CAGCAGCAGCAGGAGGGGCGCGG + Exonic
930209214 2:48617344-48617366 CAGCAGCATCAGCAGCATCTGGG - Intronic
930716104 2:54595561-54595583 GAGCAGCAGCACCAGCAGCATGG - Intronic
931243273 2:60471384-60471406 AAGAAGCAGCAGAATCAGCTGGG - Intronic
931881394 2:66574868-66574890 CAGCCGCAGCAGCAGCAGCAGGG + Intergenic
931889971 2:66661351-66661373 CAGCAGCTGCAGTGGCAGTGAGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932593710 2:73081500-73081522 CGGCAGCAGTGGCAGCAGCGGGG + Intronic
933336321 2:80964195-80964217 TAGCAGCAGCAGCAGCAGCATGG + Intergenic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
933548159 2:83740794-83740816 CAGCTGGAGCTGAAGCAGCTAGG + Intergenic
933881450 2:86673967-86673989 CAGCAGCACCAGCAGCACCTGGG - Intronic
933945309 2:87281148-87281170 ACCCAGCAGCAGGAGCAGCGGGG + Intergenic
934325365 2:92009211-92009233 GAGCAGCAGCAGGAGCTGCCAGG + Intergenic
934463736 2:94239976-94239998 GAGCAGCAGCAGGAGCTGCCAGG + Intergenic
934770425 2:96904199-96904221 CAGCAGCAGCAACAGCACAGTGG + Intronic
935834671 2:107037365-107037387 CAGCAGATGCAGTAGCAGAGAGG - Intergenic
935848116 2:107188213-107188235 CAGCAGCAGCAGTAACAGCACGG - Intergenic
935852816 2:107241726-107241748 GAGCAGCAGCAGCAGCAGACAGG + Intergenic
936334898 2:111580443-111580465 ACCCAGCAGCAGGAGCAGCGGGG - Intergenic
936380923 2:111985265-111985287 CAGCAGCAGGAAAGGCAGCTGGG + Intronic
936401555 2:112168448-112168470 CAGCAGCTGCTGGAGCAGCTTGG - Intronic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936712065 2:115142886-115142908 CACCACCAGCAGCAGCAGCAAGG - Intronic
936781624 2:116039827-116039849 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
936906006 2:117536398-117536420 AAGCAGGAGCAGCAGCAGCAAGG + Intergenic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937303023 2:120854860-120854882 CAGCAGCAGCAGCAGCATCTGGG - Intronic
937338729 2:121077486-121077508 CGGCAGGGGCAGAAGCAGCTGGG - Intergenic
938117228 2:128610199-128610221 AAACAGCACCAGAAGCAGCCGGG - Intergenic
938141784 2:128800363-128800385 AGGCAACAGCAGAAGCAGCCAGG + Intergenic
938163625 2:129008190-129008212 CAGCAGGAGCAGGAGCATGGTGG - Intergenic
938259881 2:129887989-129888011 CATCAGCAGTAGAAGCAGGCAGG + Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938282892 2:130078710-130078732 CCACAGTAACAGAAGCAGCGTGG + Intronic
938333525 2:130467278-130467300 CCACAGTAACAGAAGCAGCGTGG + Intronic
938356288 2:130653393-130653415 CCACAGTAACAGAAGCAGCGTGG - Intronic
938379331 2:130827798-130827820 CAGCACCAGCACAACCAGCTCGG - Intergenic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
938476730 2:131622449-131622471 CCACAGTAACAGAAGCAGCGTGG - Intergenic
938483743 2:131682512-131682534 CCCCTGCAGCAGCAGCAGCGTGG + Intergenic
938693686 2:133815742-133815764 CAGCAGCAGTGGCAGCAGCAGGG - Intergenic
939244934 2:139610726-139610748 CCCCAGCAGCAGCAGCAGTGTGG - Intergenic
939560037 2:143721141-143721163 CAGCAGCAGCAGTGGCACCTGGG - Intronic
939667088 2:144965427-144965449 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
939986343 2:148833153-148833175 CAGCAGCACCAGCAGCACCTGGG - Intergenic
940428514 2:153558396-153558418 CAGCAGCAGCTTAAGAAGAGTGG + Intergenic
940531708 2:154886335-154886357 CAGCAGCTGCAGTAGCACAGTGG + Intergenic
940962208 2:159798157-159798179 CAGCAACGGCAGCAGGAGCGCGG + Exonic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941389571 2:164894990-164895012 CAGCAGCAGCAGCATCACCTGGG + Intergenic
941638273 2:167960078-167960100 CAACAGCAGCAGATGCAGGAAGG + Intronic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
942139780 2:172966459-172966481 GAGCAGCAGCAGCAGCATCTGGG - Intronic
942178163 2:173354868-173354890 CAGGAGGAGCAGCAGCAGCGCGG - Exonic
942241035 2:173964439-173964461 CTGCAGCAGCAGCAACAGCACGG - Exonic
942461169 2:176169844-176169866 CAGCAACAGCACCAGCAGCCTGG - Intronic
942802646 2:179893172-179893194 CAGAAGAAGCAGAAGCTGCCAGG + Intergenic
943093747 2:183404535-183404557 CAGCAGCAGCAGCAGCCATGTGG + Intergenic
943351951 2:186806302-186806324 CAGCAGGGGCAGAAGCCGCAGGG + Intergenic
943396714 2:187346839-187346861 AATCAGCAGCAGCAGCAGCAGGG + Intronic
943571469 2:189580473-189580495 CAGCCGCAGAAGAGCCAGCGGGG - Exonic
944471301 2:200055930-200055952 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
944643784 2:201756854-201756876 CAGCAGCATCAGCAGCATCTGGG - Intronic
944655538 2:201873520-201873542 CAGCTGCAGCAGCAGCAGCATGG - Intronic
944743660 2:202635320-202635342 CAGCAGCAGCAGCAGCAACATGG + Exonic
945181573 2:207097063-207097085 CAGCAGCATCAGCATCAGCTGGG - Intronic
945251368 2:207768689-207768711 TAGGAGCAGCAGCAACAGCGAGG + Exonic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
945521492 2:210833095-210833117 CAGTTGCAGCAGAAGCAGGTAGG + Intergenic
945930981 2:215854573-215854595 CAGCTGAAGCCGAAGCAGCTGGG - Intergenic
945986484 2:216358520-216358542 CAGCAGAAGTAGAAGCAGCGTGG + Intronic
946709605 2:222492474-222492496 CAGCTGGAGCTGAATCAGCGGGG + Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
947140451 2:227015343-227015365 CAGCAGCAGCGGCAGCACCTGGG + Intronic
947205599 2:227658288-227658310 CAGCAGCAGCAGCAACACCTGGG - Intergenic
947399054 2:229714358-229714380 CAGCAGCAGCAGGGCCAGCGCGG + Exonic
947722584 2:232378813-232378835 CAGCAGCAGCAGCAGCATGCAGG - Exonic
948006851 2:234616801-234616823 CGGCAGTAGCAGCAGAAGCGAGG + Intergenic
948006852 2:234616804-234616826 CAGTAGCAGCAGAAGCGAGGAGG + Intergenic
948174703 2:235934112-235934134 CAGCAGCAGCAGCAGCCCCTGGG + Intronic
948657252 2:239484268-239484290 CAGCTCCTGCAGAAGAAGCGAGG + Intergenic
948992760 2:241563151-241563173 CGGGAGCAGCAGGAGCAGGGAGG - Intronic
1168958889 20:1854770-1854792 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1168969930 20:1924069-1924091 CAGTAACAGAAGAAGCAGCCAGG + Intronic
1169006989 20:2215881-2215903 TAGCAGCAGCAAAAGGGGCGTGG - Intergenic
1169065614 20:2692925-2692947 GAGCAGCAGCAGCAGCAGCCCGG - Exonic
1169111295 20:3035892-3035914 CAGAAGCAGCAGCAGCAGTCAGG + Exonic
1169195917 20:3681951-3681973 TAGTAGCAGCAGCAGCAACGGGG + Exonic
1169832506 20:9839448-9839470 CAGCAGCAGCATCACCTGCGAGG - Intergenic
1170150524 20:13221793-13221815 CCCCAGCAGCAGCAGCAGCTCGG - Exonic
1170330199 20:15201046-15201068 CAGCAGCAGCAGCACCTGGGAGG - Intronic
1170330200 20:15201049-15201071 CAGCAGCAGCAGCAGCACCTGGG - Intronic
1170331199 20:15212823-15212845 CAGCAGCATCAGCAGCATCTGGG + Intronic
1170331710 20:15219365-15219387 CAGCAGGAGTAGGAGCAGGGTGG - Intronic
1170545592 20:17433505-17433527 CAACAGGAGCAGAGGCAGAGAGG + Intronic
1170629729 20:18056791-18056813 CGGCAGCGGCAGCAGCAGCGCGG - Exonic
1170634902 20:18095653-18095675 CAGCAGCAGCAACAGCACCTGGG - Intergenic
1170664887 20:18378290-18378312 CAGGACCAGAAGCAGCAGCGAGG + Intergenic
1170804981 20:19621716-19621738 CAGCAGCAGCAGCAGAACCCAGG - Intronic
1170855299 20:20047704-20047726 CAGGAGCAGCAGCAGCATCCAGG + Intronic
1170913180 20:20595481-20595503 AACCAGATGCAGAAGCAGCGAGG + Intronic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1171071271 20:22070645-22070667 CAGCAGCATCAGCACCAGCTAGG - Intergenic
1171229502 20:23472122-23472144 CAGCAGCTGCAAAAGCAGAAGGG + Intergenic
1171847145 20:30284084-30284106 CGGCGGCAGCAGGAGCATCGCGG + Intergenic
1172042296 20:32053868-32053890 CAGCAGCAGCAGCATCACCGGGG - Intronic
1172100845 20:32483431-32483453 CAGCAGCAGCTGGAGCTGTGGGG - Exonic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172526222 20:35601884-35601906 CAGCAGCCCCAGGCGCAGCGCGG + Intergenic
1172555853 20:35840661-35840683 CAGCAGCAGCAGCAACATCTGGG + Intronic
1172970930 20:38872620-38872642 CAGCAGCAGCAGCAGCACCTGGG - Intronic
1173282889 20:41645056-41645078 CAGCAGCAGCAGTAGCTATGGGG + Intergenic
1173541337 20:43854034-43854056 CAGCAGCCGCAGATGCAGGACGG - Intergenic
1173620116 20:44430115-44430137 CAGCAGCAGAAGGAGGAGCAAGG - Exonic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1173856000 20:46251223-46251245 CAGCAGCAGCAGTAGCGCGGGGG + Exonic
1173882292 20:46424640-46424662 CAGTAGCAGCAGAAGAACCTGGG + Intronic
1174298853 20:49568063-49568085 TAGCAGCAGCAGCAACAGTGCGG + Exonic
1174734998 20:52957392-52957414 CAGCAGCAGCAGCAGCACCTGGG + Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175034846 20:55990351-55990373 GAGCAACATCAGAAGCAGCTGGG - Intergenic
1175166058 20:57045480-57045502 CTGCAGCATCAGCAGCATCGGGG + Intergenic
1175429560 20:58891842-58891864 CAGCAGCAGCAGGCGGTGCGTGG - Intronic
1175501060 20:59451160-59451182 TAGAAGCAGCAGCAGCAGCAAGG - Intergenic
1175546291 20:59780162-59780184 GAGCAGCAGCACAGGCAGCTGGG - Intronic
1175564049 20:59958752-59958774 CACTAGAAGCAGCAGCAGCGAGG - Exonic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175668010 20:60876902-60876924 AAGCAGCAGTGGCAGCAGCGGGG - Intergenic
1175741499 20:61422851-61422873 CAGCAGCAGGAGAAGCACTGAGG - Intronic
1175794793 20:61764884-61764906 CGGCAGCAGCAGAAGCCTCCAGG - Intronic
1175834884 20:61987081-61987103 CAGCAGCAGCAGCAACAGCCAGG + Intronic
1175983669 20:62753789-62753811 TGGCAGCAGCAGAACCAGCCAGG - Intronic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1176241151 20:64076543-64076565 CAGCACCAGCACAGGCAGCAGGG + Exonic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176594777 21:8682989-8683011 GAGCAGCAGCAGGAGCTGCCAGG + Intergenic
1176680256 21:9815602-9815624 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176680538 21:9817011-9817033 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176684753 21:9838120-9838142 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176818108 21:13626731-13626753 CAGCAGCAAGAGCAGGAGCGAGG - Intronic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177913828 21:27062944-27062966 CAGCTGCAGCATAAGCAGGTGGG - Intergenic
1178135264 21:29619774-29619796 AAGCAGCAACAGAAGCAGCATGG + Intronic
1178320595 21:31602255-31602277 CAGCAGCAGCAGAAGAAAACTGG + Intergenic
1178596851 21:33962131-33962153 CAGCAACAGCAGAAGAACCTGGG + Intergenic
1178636732 21:34310045-34310067 CAGCAGCATCAGCAGCACCTGGG - Intergenic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1179035044 21:37752465-37752487 CAACAGCAGCAAAAGCCGAGAGG + Intronic
1179593424 21:42426748-42426770 AGCCAGCAGCAGATGCAGCGGGG + Exonic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1179797100 21:43791452-43791474 GAGCAGGTACAGAAGCAGCGGGG + Intronic
1179974882 21:44859063-44859085 CAGCAGCACCAGAAGGACCCAGG + Intronic
1179976921 21:44873536-44873558 GATGAGCAGCAGGAGCAGCGCGG + Exonic
1180009501 21:45040319-45040341 CCACAGCAGCAGCAGCAGCATGG - Intergenic
1180018158 21:45101011-45101033 CAGCAGCAGCAGCGCCAGTGCGG + Intronic
1180030910 21:45206960-45206982 CAGCAGCAGCAGAGAGAGCCTGG + Intronic
1180277634 22:10660159-10660181 GAGCAGCAGCAGGAGCTGCCAGG + Intergenic
1180584867 22:16878981-16879003 GAGCAGCAGCAGGAGCTGCCAGG + Intergenic
1180614872 22:17120598-17120620 CAGCCGCAGCAGCAGCAACACGG + Exonic
1180614979 22:17120962-17120984 CAGCACCAGCACCAGCCGCGGGG - Exonic
1180740853 22:18052400-18052422 CAGCAGCAGCAGAGGCACCGGGG + Intergenic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1180871633 22:19150075-19150097 CAGCAGCAGCAGCAGGCGCAGGG + Exonic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181235459 22:21445591-21445613 CAGCACCAACGGGAGCAGCGGGG + Exonic
1181323624 22:22027798-22027820 CAGAAGTAGCAGAAACAGGGTGG + Intergenic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181560174 22:23695431-23695453 CAGCAGCAGCAGCAGAGGCCTGG - Intronic
1181572026 22:23772920-23772942 GAGCAGCAGCAGCAGCATCGGGG - Exonic
1181617878 22:24067162-24067184 CACCTGCAGAAGAAGCAGCTGGG - Exonic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182281048 22:29217851-29217873 CACCAGCAGGAGAAGCAGCTTGG - Intronic
1182428689 22:30288109-30288131 CAGCAGCAGGAGGAGGAGCTAGG + Intronic
1182445116 22:30385496-30385518 CAGCAGCAGCAGTGGCAACGGGG + Intronic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1182788062 22:32924487-32924509 CAGCAGCATCAGCAGCATCCAGG + Intronic
1183083095 22:35469721-35469743 CAGCAGCAGAAGACAGAGCGGGG + Intergenic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183485601 22:38086271-38086293 CAGCAGCCGCCGCAGCAGCATGG - Exonic
1183585852 22:38752550-38752572 CAGCAGCAGCGGAGGGAGCTCGG - Exonic
1183719509 22:39554343-39554365 CAGCAGCTGCTGCAGCAGCAAGG + Intergenic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184380580 22:44142855-44142877 CTGCGTCAGCAGAAGCAGCAAGG - Intronic
1184559685 22:45254878-45254900 CAGCGGCAGCAGAATCAGCAGGG - Intergenic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1185045314 22:48525681-48525703 CAGCAGCAGCAGCAGCTTCTGGG - Intronic
1185073617 22:48670589-48670611 AAGCAGGAGCAGTAGCCGCGTGG + Intronic
1185236462 22:49716420-49716442 TTGCAGCACCAGCAGCAGCGAGG - Intergenic
1185313974 22:50170843-50170865 CTTCAGCTGCAGAAGCAGCGCGG - Exonic
1203296105 22_KI270736v1_random:44445-44467 CAGAAGCAGCACAGGCAGAGGGG - Intergenic
949150943 3:766261-766283 CACCAGAAGGAGAGGCAGCGTGG + Intergenic
949709930 3:6861370-6861392 CCGCAGCAGCCGGAGCAGCATGG + Exonic
949743507 3:7263412-7263434 CAGCAGTGGCAGCAGCAGCATGG + Intronic
949980265 3:9498421-9498443 CAGCAGCAGCAGAAGGGGTCAGG + Exonic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950276795 3:11668421-11668443 CAGCAGCATCAGTGGCAGCTGGG + Intronic
950435676 3:12978321-12978343 CAGCAGCAGCAGCCTCAGCTGGG + Intronic
950660100 3:14461870-14461892 CAGCAGCAGCAGGGGGAGCCAGG - Intronic
950811436 3:15653121-15653143 CAGCAGCACCAGTAGCACCTGGG + Intergenic
950847563 3:16029753-16029775 CAGAAGAAGCAGAAACAACGGGG - Intergenic
950971502 3:17193179-17193201 CTGAAGCAGCACAATCAGCGAGG - Intronic
950990682 3:17434477-17434499 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
951477199 3:23119469-23119491 GAACAGCAGCAGCAGCAGGGGGG - Intergenic
951529179 3:23682747-23682769 CAGCAGCAACAGCAGCACCTGGG - Intergenic
951592104 3:24277513-24277535 CAGCAGCATCAGCATCACCGGGG - Intronic
951709063 3:25571345-25571367 GACCAGCAGCATAAGCAGCCTGG - Intronic
951937016 3:28033189-28033211 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
951995196 3:28719729-28719751 CAGCAGCAGCAGCATCACCTGGG - Intergenic
952055118 3:29434811-29434833 CAGCAGCAACAACAGCAGCGGGG + Exonic
952141140 3:30480371-30480393 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
952157167 3:30655910-30655932 CAGCAGCAGCAGGATCACCCGGG + Intronic
952192732 3:31041367-31041389 CAGCAGCAATAGCAGCAGCTGGG + Intergenic
952251967 3:31664300-31664322 CAGGAGCAGCCAGAGCAGCGAGG + Intronic
952480248 3:33753902-33753924 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
952504550 3:33995995-33996017 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
952644648 3:35640087-35640109 CAGCAGCAGCAGGGGCAGCGGGG + Intronic
952884690 3:38005284-38005306 TGGCTGCAGCAGAAGCAGTGAGG - Intronic
952942490 3:38454762-38454784 CAGCAGCAGCAGCAGCATGCGGG + Intronic
953801817 3:46030716-46030738 CAGCTGCAGGAGCAGCAGTGGGG + Intergenic
953854543 3:46491087-46491109 CAGAAGGACCAGGAGCAGCGAGG + Intergenic
953886602 3:46717732-46717754 CAACAGAAGCAGCAGCAGCAGGG + Exonic
953901046 3:46844601-46844623 CAGCAGCCCCAGAAGGAGCAGGG - Intergenic
954143374 3:48621718-48621740 CAGGAGCAGCAAAGGCAGCGAGG + Exonic
954206532 3:49063281-49063303 CAACAGCAGCAGCAGCATCCAGG + Intronic
954408426 3:50358533-50358555 CAGCAGCGCCAGCAGCAGCATGG + Exonic
954419869 3:50413112-50413134 CAGCGGCAGCAGCAGCTGGGTGG - Intronic
954423008 3:50428513-50428535 CATTAGCAGCAAAAGCAGGGCGG + Intronic
954437156 3:50502538-50502560 CAGCAGCAGCAGGCGCAGGCAGG + Intronic
954540717 3:51391570-51391592 CCGCGGCAGCGGAAGCGGCGGGG + Exonic
955096369 3:55801970-55801992 CAGCAGCATCAGTAGCACCCAGG - Intronic
955778805 3:62462242-62462264 CTTCAGCAGCAGTAGCAGCCTGG - Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956193467 3:66629571-66629593 TTGCTGCAGCAGCAGCAGCGGGG + Intergenic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
956609145 3:71104395-71104417 CAGCAGCAACAGCAGCAGAAGGG - Intronic
956716563 3:72085218-72085240 CAGCAGCAGCTGCAGCTGCATGG + Intergenic
956780276 3:72597942-72597964 CAGCAGTAGCAGCAGCAGCAGGG + Intergenic
956813608 3:72888280-72888302 CAGCAGCGCCAGCAGCAGCGCGG - Exonic
957374292 3:79336380-79336402 CAGCTGGAGCTGAAGCAGCTGGG - Intronic
957857263 3:85894731-85894753 CAGCTGGAGCTGAAGCAGCTGGG - Intronic
957982258 3:87525442-87525464 CAGCTGGAGCTGAAGCAGCTAGG - Intergenic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
958991625 3:100852616-100852638 CAGCAGGACCAGAAACAGCAGGG + Intronic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959362529 3:105411443-105411465 TAGTAGCAGCAGCAGCAGCTGGG + Intronic
959389200 3:105752870-105752892 CAGCAGCAGCAGCAGCCTCAGGG - Intronic
959955352 3:112231802-112231824 CAGCAGCATCAGAATCACCTGGG + Intronic
960687417 3:120307920-120307942 GAGCAGGAGCAGCAGCAGCAAGG + Intergenic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
961087308 3:124079173-124079195 CAGCTGCAGAGGAAGCAGAGGGG + Intergenic
961133455 3:124489724-124489746 CAGCAGCAGCAACAGCACCTGGG + Intronic
961503838 3:127356966-127356988 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
961531620 3:127543724-127543746 GGGCAGGAGCAGAAGCAGCAAGG + Intergenic
961602525 3:128072580-128072602 CAGCAGGTGCAGAGGGAGCGCGG - Intronic
961823467 3:129586884-129586906 CAGCAGAGGCAGAAGCATCAAGG - Intronic
961856710 3:129878734-129878756 CAGCAGCAGCAGCAGCACCTGGG + Intronic
961988117 3:131158689-131158711 CAGCAGCAGCAGAGACAGAATGG - Intronic
961994084 3:131222726-131222748 CAGCAGCATCAGCATCAGCTGGG + Intronic
962066980 3:131991838-131991860 CAGCTGGAGCTGAAGCAGCTTGG - Intronic
962212740 3:133492310-133492332 CAGCAGCTGCAGCAGCATGGCGG - Intergenic
963043137 3:141083603-141083625 CAGCACAAGCAGAAGCATGGAGG - Intronic
963117020 3:141738672-141738694 CAGGAGCCGCAGCAGGAGCGTGG - Intronic
963430008 3:145188614-145188636 CAGCAGCACCAGCAGCATCTGGG + Intergenic
963515810 3:146306625-146306647 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
963671588 3:148258376-148258398 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
963733834 3:148996785-148996807 CAGCAGCACCAGACCCAGGGTGG + Exonic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964546831 3:157843566-157843588 CAGCAGCAGCAAAATGAGCAAGG + Intergenic
964622625 3:158732329-158732351 CAGCAGCAGCGCGAGCAGCGGGG + Exonic
964989124 3:162784952-162784974 CAGCAGCATCAGAATCATCTGGG + Intergenic
965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG + Intergenic
966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG + Intronic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966921872 3:184617473-184617495 CAGCAGCAGCAGCAGCAAGATGG + Intronic
967115422 3:186333192-186333214 CAGCAGCATCAGCACCACCGGGG + Intronic
967126734 3:186430734-186430756 CAGCAGCAACTGAAGCAGCTGGG - Intergenic
967406176 3:189118624-189118646 CAGCTGGAGCTGAAGCAGCTGGG - Intronic
967659603 3:192090707-192090729 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
967826962 3:193884746-193884768 AAGCAGCAGCAGAGTCAGCTGGG + Intergenic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968509608 4:989655-989677 CAGCAGCACCAGCAGCACCACGG + Exonic
968967850 4:3778339-3778361 CAGCTGCAGCAGCAGCAGCTGGG + Intergenic
969006136 4:4021336-4021358 CAGCAGCAGCAGCAGCTGGAGGG + Intergenic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969438521 4:7202815-7202837 CATCAGAAGCAGAAGCTGGGAGG - Intronic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969671547 4:8592841-8592863 AAGGAGCAGCAGCGGCAGCGGGG - Exonic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
969695187 4:8730251-8730273 CAGCAGCATGAGAAGGAGCAGGG + Intergenic
969806812 4:9615954-9615976 CAGCAGCAGCAGCAGCTGGAGGG - Intergenic
970016767 4:11520671-11520693 CAGCAGCAGCACATTCAGCCTGG - Intergenic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970592562 4:17572212-17572234 CAGCAGCAGCAGCAGCAAGATGG - Intergenic
970689609 4:18607415-18607437 CAGCAGCAGCGGCATCAGCTGGG - Intergenic
971197446 4:24482992-24483014 CAGCAGCAGCAGCAGCCTCCAGG - Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
972200847 4:36713332-36713354 CAGCAGCAGCAGTAACAACAAGG - Intergenic
972205313 4:36764903-36764925 CAGCAGCTGGAGAAGCACTGTGG + Intergenic
972270043 4:37502306-37502328 CAGCAGTGGCAGAGGCAGCATGG + Intronic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973643127 4:52923028-52923050 CAGCTGCATCAGACACAGCGAGG + Intronic
973697856 4:53508225-53508247 CAGCTGTAACAGAACCAGCGGGG + Exonic
973830284 4:54752502-54752524 CAGCAGCAGCTGAAGCAGGAGGG + Intergenic
973894256 4:55396230-55396252 CAGAAAGAGCAGAAGCAGCCGGG - Exonic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
973982221 4:56316118-56316140 CAGCAGCACCGGAGACAGCGCGG + Exonic
974811997 4:66956992-66957014 CAGCTGGAGCTGAAGCAGCCGGG + Intergenic
975406641 4:73998321-73998343 CAGCAGCGGCAGGACCAGCTGGG + Exonic
975511117 4:75194415-75194437 CAGCGGCAGCAGTGGCAGTGTGG - Intergenic
976088181 4:81427732-81427754 AAGCAGCAGCAGCAGCAGGCAGG + Exonic
976441840 4:85084980-85085002 CAGCAGGAACAGCAGCAGCTGGG - Intergenic
976635957 4:87286712-87286734 CAGCTGGAGCTGAAGCAGCTAGG - Intergenic
977197526 4:94081504-94081526 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
977320009 4:95501944-95501966 CAGCCACAGCAGAAGAAGAGAGG + Intronic
977862560 4:101982079-101982101 CAGCTGCAGCAGACCCAGGGAGG - Intronic
978689005 4:111484026-111484048 CAGCAGCACGAGCAGCAGCATGG - Intergenic
978885356 4:113761467-113761489 CAGGAGGAGTAGAAGCAGAGGGG + Intronic
978923777 4:114217731-114217753 CAGCAGCAGCATAGGCAGTGTGG - Intergenic
979076331 4:116275320-116275342 CAGCAGAAGTAGCAGCAGTGTGG - Intergenic
979471889 4:121108705-121108727 CAGCAGCAGCAACATCAGCTGGG - Intergenic
979544732 4:121926827-121926849 CAGCAGCATCAGCAGCACCTGGG + Intronic
979678065 4:123431163-123431185 AAGAAGCAGCAGCAGCAGCAGGG - Intergenic
979812508 4:125055356-125055378 CCCCATCAGCAGAAGCAGCTAGG + Intergenic
979975472 4:127190732-127190754 CTGCAGTAGCAGCAGCAGCTGGG + Intergenic
980027119 4:127781014-127781036 CTACAGCAGCAGCAGCAGCAAGG - Intergenic
980153733 4:129080004-129080026 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
980335538 4:131468846-131468868 CAGCCACAGCTGAAGCAGCTTGG - Intergenic
980559979 4:134460243-134460265 CAGCTGGAGCTGAAGCAGCTAGG - Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980920776 4:139083870-139083892 GAGCAGCAGCAGCAGCTGCCGGG - Intronic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981076225 4:140595175-140595197 CAGCTGCAGCACAAGCAGGTAGG + Intergenic
981242370 4:142493010-142493032 CAGCTGAAGCTGAAGCAGCTGGG - Intronic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
982215602 4:153080302-153080324 CAGTAGCAGCAGCAGCAGCCAGG + Intergenic
982257627 4:153466237-153466259 CAGCAGCTGCGGCAGCGGCGGGG + Intergenic
982315842 4:154031032-154031054 CAGCAGCATCAGAAGCCCCAGGG + Intergenic
982390541 4:154858436-154858458 GAGCAGCAGCAAGAGCAGTGAGG - Intergenic
983130438 4:164012526-164012548 TAGCAGCAGCAGCAGCAGCCAGG + Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983269147 4:165540385-165540407 CAGCAGAAGCAGAAGCATTTTGG + Intergenic
984057541 4:174948652-174948674 CAGCAGCTGCAGCAGCATGGTGG + Intronic
984372148 4:178882228-178882250 CAGCAGGAGCTGGAGCAGCTGGG - Intergenic
984473863 4:180213045-180213067 CAGCAGCAGCAGAATAAAAGAGG - Intergenic
984810960 4:183796552-183796574 CAGCAGTAGCAGCAGCATCTGGG + Intergenic
984820518 4:183877660-183877682 CAGCAGCAGCAGCGGAAGTGCGG - Intronic
985085586 4:186309258-186309280 CAGCAGCAGCAGAGGCGCCTGGG - Intergenic
985093823 4:186392093-186392115 CAGCAGCAGCAGCAGCATCTTGG + Intergenic
985099215 4:186441698-186441720 CAGCATCAGCTGAAGAAGCCTGG + Intronic
985279473 4:188270965-188270987 CACCAGCAGCAGCAGCAGCCTGG + Intergenic
985675085 5:1226787-1226809 GAGCCGCAGCACAGGCAGCGAGG - Intronic
986296937 5:6447072-6447094 CACCAGCAGCAGCGGCAGCAAGG + Intergenic
986329958 5:6710779-6710801 CAGCAACACCAGAAGCTGAGAGG + Intergenic
986451534 5:7869664-7869686 CAGCAGCCCCGGAAGCGGCGCGG - Intronic
986466924 5:8034997-8035019 GAGCAGCAGCAGCACCAGGGAGG + Intergenic
987209780 5:15669011-15669033 CAGCAGCAGCAGAAACAATAAGG - Intronic
987385839 5:17328530-17328552 CAGCAGCAGCAGCATCACCTGGG - Intergenic
987909425 5:24122484-24122506 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
988236458 5:28551236-28551258 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
988397033 5:30708522-30708544 CAGCTGGAGCTGAAGCAGCCAGG - Intergenic
988496236 5:31748556-31748578 CCCCAGCAGCAGAAGCTGTGGGG + Intronic
988865048 5:35324992-35325014 CAGCAGCAGCAATGGCAGCATGG - Intergenic
989218323 5:38927533-38927555 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
989341976 5:40386378-40386400 CAGCAACAGCAGCAGCAGCTGGG - Intergenic
989710177 5:44388612-44388634 AAGCAGCAGCAGCAGCAGCCGGG + Exonic
990009788 5:50983041-50983063 CAGAGGCAACAGAAGCAGAGAGG - Intergenic
990165537 5:52989491-52989513 CAGCAGCAGCGGCAGCGGCGCGG - Exonic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
991077653 5:62559455-62559477 AAGCAGCAGCAGAATCTGAGAGG - Intronic
991433402 5:66571599-66571621 CAGCAGCATCAGCAGCACCTTGG + Intergenic
991654257 5:68887278-68887300 CAGCAGCAGCAGTAGCTGCAAGG + Intergenic
992039491 5:72816363-72816385 CAGCAGCTGCAGACGCTGCCCGG - Exonic
992146723 5:73858055-73858077 CAGCAGCAGCAGTAGGAAAGTGG - Intronic
992825021 5:80540307-80540329 CAGCAGCTGAGGAAGCAGCTTGG - Intronic
993178451 5:84518560-84518582 CAGCAGTGGCAGAGGCAGCATGG + Intergenic
994353907 5:98774150-98774172 CAGCAGCAGCTCCAGCGGCGGGG - Exonic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
994559408 5:101347783-101347805 CAGCTGCAGCAAAAGCAGATGGG - Intergenic
994643015 5:102433746-102433768 CAACAGCAGCAGCGGCAGCATGG + Intronic
994946807 5:106404605-106404627 CAGTAGCAGGAGATGCAGGGAGG + Intergenic
994970565 5:106731286-106731308 CACCAGCAGCAGTGGCAGCATGG - Intergenic
995026228 5:107426365-107426387 CAGTAGCAGCAGCAGCATCTGGG + Intronic
995068440 5:107889755-107889777 CTTAAGCAGCAGCAGCAGCGAGG + Intronic
996167011 5:120236611-120236633 TTCCAGCAGCAGCAGCAGCGTGG + Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996581389 5:125035889-125035911 GAGCAGCATCAGAAGCGGAGGGG + Intergenic
997001064 5:129762594-129762616 CAGCAGCAGCACAATCAGTCAGG + Intronic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998308502 5:141102616-141102638 CACCAGGAGCACATGCAGCGTGG - Exonic
998799638 5:145856365-145856387 CAGGAGCAGCAGCAGCAGCTAGG - Intergenic
998820606 5:146054357-146054379 CAGCAGTAGCAGCAGCAGCAAGG - Intronic
998940870 5:147280615-147280637 CCACAGCAGCAGCAGCAGCAAGG + Intronic
998977002 5:147659328-147659350 GAGAACCAGCAGAAGCAGGGTGG - Intronic
999103204 5:149044916-149044938 CGGCAGCAGCAAAAGAAGCCAGG + Intronic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999363620 5:151006824-151006846 CAGCAGCAGCACAATCAGTGGGG - Intergenic
999868927 5:155729681-155729703 TAGAAGCAGCAGAGGCAGCCCGG - Intergenic
1000220183 5:159208205-159208227 CAGCAGTAGCAGCAGCAACCGGG + Intronic
1000990171 5:167903715-167903737 CAGCAGCATCAGCAGCATCTGGG + Intronic
1001065892 5:168534874-168534896 CCTCTGCAGCAGAGGCAGCGAGG + Intergenic
1001236171 5:170031422-170031444 CAACAGGAGCAGAAGCAGTGTGG + Intronic
1001847304 5:174933667-174933689 CAGCAGCAGCAAGACCAGCAGGG - Intergenic
1002021192 5:176365477-176365499 CGGCCGCAGCAGTCGCAGCGGGG + Exonic
1002026310 5:176398091-176398113 CAGGGGCAGCAGAGACAGCGGGG - Intronic
1002322070 5:178382224-178382246 CAGCCGCAGCAGCTGCAGCTGGG - Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002645235 5:180649535-180649557 CAGCGGCCGGAGATGCAGCGGGG - Exonic
1002660460 5:180788026-180788048 ATGCAGCAGCAGCAGCAGCCAGG + Intergenic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003230058 6:4243667-4243689 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003624158 6:7727298-7727320 CAGCAGCAGCAGCTGCCTCGCGG + Exonic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1004320349 6:14627000-14627022 CATCTGCAGCAGCAGCAGTGTGG + Intergenic
1004330583 6:14717024-14717046 CTGCAGCAGCTGAAGCAGCCAGG + Intergenic
1004518897 6:16344029-16344051 CAGCAGCATCAGCAGCATCTGGG - Intronic
1004732208 6:18368677-18368699 CAGCAGCAGCAGCGGCTGCGCGG - Intergenic
1004753131 6:18583916-18583938 TATCAGCAGCAGAGGCAGAGAGG + Intergenic
1004997665 6:21209758-21209780 CAGCAGCAGCAGAACCTGAAAGG + Intronic
1005455688 6:26017687-26017709 CAGGAGCAGCAGAAGCGGCGGGG + Exonic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006125874 6:31837731-31837753 GAGCAGCAGCAAAGGCAGGGAGG + Intronic
1006390836 6:33757329-33757351 CATCAGCTGCACAAGCAGGGAGG - Intergenic
1006738663 6:36292515-36292537 CAGCAGCAGGCAAAGCAGTGTGG - Intronic
1006793694 6:36719309-36719331 GAGCAGCAGCAGAGGCACCTGGG - Intronic
1007221460 6:40282243-40282265 GAGCAGCAGCAGCAGCACTGGGG - Intergenic
1007276702 6:40679454-40679476 CATCAGCAGAAGAATCAGGGAGG + Intergenic
1007317900 6:41004109-41004131 CAGCAGGAGAAGAAGCAGCCTGG - Intergenic
1007323610 6:41043941-41043963 CAGCAGCAGCAGGTGCAGCAGGG - Exonic
1007339920 6:41184885-41184907 CAGCAGCAGCAGCAGCACAACGG + Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007350748 6:41271936-41271958 GAGCAGCAGCAGCAGCAGCCAGG + Intronic
1007387226 6:41528157-41528179 CAGCGGCAGCGGTGGCAGCGAGG + Intergenic
1007415915 6:41691077-41691099 CAGCAGCAACAGCAGCAGCTCGG - Exonic
1007446792 6:41912784-41912806 CAGCAGTAGCAGAACCACCTGGG + Intronic
1007506320 6:42337938-42337960 CAACAGCAGCAGCAGCACCTAGG + Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007654838 6:43445762-43445784 CGGCAGCAGGAGCAGCAGCCAGG - Exonic
1007680287 6:43629051-43629073 CGGCAGCAGCAGCGGCTGCGGGG - Exonic
1007769877 6:44183959-44183981 TACCAGCAGCAGCAGCAGCGAGG + Exonic
1008036461 6:46750024-46750046 CAGCAGCAGCAGCAGCCCCTGGG - Intronic
1008383662 6:50862172-50862194 CAGCAGTAGCAGCAGAAGCAAGG + Intergenic
1008469373 6:51866040-51866062 CAGCAGCAGCAGCAGCACCAGGG - Intronic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1009308887 6:62125163-62125185 TAGCAGCAGCAGTAGCTGTGTGG + Intronic
1009573639 6:65423568-65423590 CAGCAGCATCAGAATCACCTGGG - Intronic
1009621556 6:66084647-66084669 CAGCAGGAGCAGCAGCACAGTGG + Intergenic
1009803908 6:68577332-68577354 CAGCAGCAGCAGCAGCATTTGGG + Intergenic
1010061226 6:71625345-71625367 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1010083140 6:71886860-71886882 CAGCAGCAGCAGCAGAGCCGGGG - Intronic
1011016912 6:82767153-82767175 CAGCAGCAGCAGCATCACCTGGG + Intergenic
1011071778 6:83393020-83393042 CAGCACCAGTAGAGGCAGAGAGG - Intronic
1011290482 6:85772062-85772084 CAGCAGCAGCAGTGGCAGCACGG + Intergenic
1011399929 6:86949355-86949377 CAACAGCAGCAGCAGCAGCAGGG - Intronic
1011530228 6:88312892-88312914 CAGCAGCAGCAGCTGCACCTGGG + Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1011933029 6:92737867-92737889 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1011941483 6:92848489-92848511 CAGCAGCATCAGTAGCAGTTGGG - Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012490659 6:99779850-99779872 CAGCAGCAGTGGAAGCAGCATGG + Intergenic
1012616424 6:101284132-101284154 CAGCAGAAGCAGTGGCAGAGAGG - Intergenic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1012668918 6:102015653-102015675 AAGCAGTAGCAGCAGCAGCACGG - Intronic
1013031616 6:106339347-106339369 TAGCAGCGGCACAAGCATCGTGG - Intergenic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013437210 6:110122519-110122541 CAGGAGTAGCAGAGGCAGAGAGG - Intronic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1014010249 6:116467321-116467343 CAGCCCCAGCAGCAGCAGCCAGG + Intergenic
1014066714 6:117135483-117135505 CAGCAGCATCAGAATCACCAGGG - Intergenic
1014199094 6:118588999-118589021 CAACAGCAGCAGCGGCAGTGAGG - Intronic
1014592146 6:123286841-123286863 CAGCAGCAGCAGCAGCACCTGGG + Intronic
1014618614 6:123636898-123636920 AAGAAGCAGCAGAAACAGCCAGG - Exonic
1014895186 6:126892690-126892712 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1014947692 6:127516370-127516392 CTGCAGCAGCAGCAACAGCAGGG - Exonic
1015239583 6:131008213-131008235 CAGCTGGAGCTGAAGCAGCTGGG - Intronic
1015808681 6:137140001-137140023 CACCAGAAGCAGAAGCTGCACGG - Intergenic
1015878916 6:137851454-137851476 CACCAGCAGCAGCAGCAGCTGGG + Intergenic
1015919803 6:138255511-138255533 CAGCAGCACCAGTACCAGCCTGG + Exonic
1016284989 6:142462890-142462912 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1017549597 6:155491950-155491972 CAGCAGAAGCAGAAGAAACAAGG - Intergenic
1017973097 6:159329915-159329937 CAGCAGTGGCAGCAGCAGTGAGG + Intergenic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018327728 6:162691841-162691863 CTGAAGCAGCAGTAGCAGCCTGG + Intronic
1018934851 6:168267058-168267080 CCGCAGCAGCAGCAGCTGCTAGG - Intergenic
1019032297 6:169024112-169024134 AATCAGCAGCAGAAGCAGAGGGG + Intergenic
1019139315 6:169933685-169933707 CTGGAGCAGCAGATGCGGCGAGG + Intergenic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019188127 6:170232989-170233011 GTGCAGCTGCAGAAGCTGCGTGG - Intergenic
1019374847 7:683895-683917 CATCAGCTGCAGAAGAAGTGGGG - Intronic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019484193 7:1281144-1281166 CAGCAGCAGCAGCAGCCAGGAGG + Intergenic
1019593948 7:1849802-1849824 CAGCGGCAGCGGAAGCAGGACGG + Exonic
1019639899 7:2097719-2097741 CAGCAGCAGCAGGGGCTGCCCGG + Intronic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020079702 7:5280924-5280946 CAGCAGCAGAGGAAGGAGAGGGG + Intronic
1020086436 7:5313153-5313175 CAGCAGCAGCAGCAGCGGCTCGG - Exonic
1020423431 7:8036062-8036084 CAGCTACAGCAGAAGCAGATGGG - Intronic
1020607761 7:10359981-10360003 CAGAAGCAGCAGTAGCATGGCGG + Intergenic
1020760429 7:12262043-12262065 CAGAAGCAGCAGAAGAAAAGTGG + Intergenic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021146849 7:17099705-17099727 TAGCAGGAGCTGAAGCAGCTTGG - Intergenic
1021313189 7:19117183-19117205 GCGCAGCAGCAGGCGCAGCGCGG - Exonic
1021411061 7:20330682-20330704 CAGGAGCAGCAGTAACAGCTCGG - Intronic
1021429412 7:20543185-20543207 CAGCAGCAGCAGCATCACCTTGG + Intergenic
1021561361 7:21971859-21971881 GAGCAGCAGCTGCAGCAGAGAGG - Intergenic
1021570149 7:22056915-22056937 CAGCAGCAGCAGCATCACCTGGG - Intergenic
1022163070 7:27731388-27731410 CAGAAGAAGCAGAAACAGAGAGG - Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022226723 7:28371168-28371190 CAGCAGCAGAAGATTCAGGGAGG + Intronic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022480195 7:30738612-30738634 CAGCAGCAGCAGCATCACCAGGG - Intronic
1022499689 7:30874710-30874732 CAGCAAGAACAGAAGCAGAGAGG - Intronic
1022964919 7:35463871-35463893 GAGAAGCATCAGAAGCAGGGTGG - Intergenic
1022970226 7:35510405-35510427 CAGCAGCATCAGAATCACCTGGG - Intergenic
1023418304 7:39951436-39951458 CAGCAGCAGTAGCAGCCGCAAGG + Exonic
1023835712 7:44066086-44066108 CAGCAGCAGCAGAATGGGCAAGG + Intronic
1024095638 7:45980346-45980368 CAGCTGCAGCTGAAGCCACGTGG - Intergenic
1024101504 7:46037128-46037150 CAGCAGCAGCAGCACCAACAGGG + Intergenic
1024145544 7:46513003-46513025 CAGCAGCAGCAGATGCAACTGGG + Intergenic
1024212218 7:47215811-47215833 CAGCAGCTGCAGAGGCATCTGGG + Intergenic
1024300373 7:47882883-47882905 CAGCAAGAAGAGAAGCAGCGAGG + Intronic
1024306947 7:47937391-47937413 CAGGAGCAGCAGAAGTCTCGTGG + Intronic
1024607946 7:51038278-51038300 CAGGTGCTGCAGCAGCAGCGAGG + Intronic
1024947574 7:54825729-54825751 AAGCAGCAGCGGAGGCTGCGTGG - Intergenic
1025106556 7:56175493-56175515 CAGCTGCAGCGGGAGGAGCGCGG + Intergenic
1025199202 7:56951279-56951301 CAGCAGCAGAGGAAGGAGAGGGG - Intergenic
1025207876 7:57003949-57003971 CAGCAGCAGCAGCAGTGGCTCGG + Intergenic
1025664064 7:63572914-63572936 CAGCAGCAGCAGCAGCGGCTCGG - Intergenic
1025672744 7:63625654-63625676 CAGCAGCAGAGGAAGGAGAGGGG + Intergenic
1025810595 7:64872971-64872993 CAGCAGCTGCTGAGGCTGCGCGG - Intronic
1025813153 7:64888204-64888226 GGGCAGCAGCAGCAGCAGCCAGG - Intronic
1026173993 7:67979726-67979748 CAGCAGCAGGAGAAGCATGGAGG - Intergenic
1026402368 7:70027498-70027520 CAGCAGCAGCAGCATCACCTGGG + Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026734915 7:72943233-72943255 CAGCAGCGGGAGCAGCAGCTCGG + Exonic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1026785248 7:73298148-73298170 CAGCAGCGGGAGCAGCAGCTCGG + Intergenic
1027041458 7:74964575-74964597 CAACAGCAGCAACAGCACCGGGG + Intergenic
1027082182 7:75237792-75237814 CAACAGCAGCAGCAGCACCGGGG - Intergenic
1027108826 7:75421776-75421798 CAGCAGCGGGAGCAGCAGCTCGG - Exonic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1028774677 7:94663739-94663761 CAGCAGCTGCTGCAGCACCGCGG - Exonic
1028962545 7:96765491-96765513 GAGCAGCAGCAGCAGCAGCTGGG - Intergenic
1029152136 7:98488210-98488232 GAGCAGCAGCAGAACCTGGGGGG + Intergenic
1029238812 7:99144079-99144101 CGGCAGCGGCGGAAGCGGCGAGG - Exonic
1029331410 7:99859255-99859277 CAGCAGCACCAGCAGCATCTGGG - Intronic
1029403278 7:100358325-100358347 CGGCTGCAGCAGGAGCAGCAGGG - Exonic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1029715717 7:102324403-102324425 CTGCAGGCGCAGGAGCAGCGAGG + Intergenic
1030182099 7:106720936-106720958 AAGCAGCACCAGAAGAAGCAAGG + Intergenic
1030722408 7:112885110-112885132 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
1030861052 7:114629967-114629989 CAGCAGCAGCAACAGCATCCTGG + Exonic
1031396945 7:121285198-121285220 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1031702780 7:124945467-124945489 CAGCAGCAACAGTGGCAGTGTGG - Intergenic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033280924 7:140005901-140005923 CAGCAGCAGCAGCATCACCCGGG - Intronic
1033673015 7:143511272-143511294 CAGCAGCAGCAGCACCAGGCAGG + Intergenic
1034010429 7:147523623-147523645 AAGCTGCTGCAGAAGCAGAGAGG - Intronic
1034219439 7:149432647-149432669 CAGCAGCAGCGGAACCGGCGCGG - Exonic
1034261958 7:149762860-149762882 CAGCAGCATCAGGAGCAGCTGGG - Intergenic
1034331531 7:150287355-150287377 CAGCAGCAGCAGCAGCATCCTGG - Intronic
1034426346 7:151016201-151016223 CAGCAGCAGCAGGAGCCGTGGGG - Exonic
1034440035 7:151081666-151081688 CAGCAACAGCAGGAGCAGCAGGG + Exonic
1034590004 7:152130970-152130992 CAGCAGGAGCAGAAACACCCAGG + Intergenic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035165257 7:156985584-156985606 CAGCAGATGCAGGAGCAGCAGGG - Intergenic
1035297474 7:157875663-157875685 CTGCAGCAGCAGCAGCACCTTGG + Intronic
1035686674 8:1528486-1528508 CACCAGGAGCAGCAGCAGCTAGG + Intronic
1035970646 8:4244211-4244233 CAGCAGCAACAGTAACAGCTAGG + Intronic
1036422127 8:8606854-8606876 CAGCAGCAGCAGCATCACCTGGG - Intergenic
1036579689 8:10062230-10062252 CAGCAGCAGCAGCAGCTGGCTGG + Intronic
1036690782 8:10943489-10943511 CAGCAGGAGCAGATACAGAGAGG - Intronic
1036917020 8:12813971-12813993 CAGCAGCAGCAGAAGATTCCCGG - Intergenic
1037143057 8:15540507-15540529 CAGCAGCAGCAGGAGAAGGAAGG - Exonic
1037150026 8:15626066-15626088 CAGGAGCAGCAGTGGCAGTGGGG + Intronic
1037538396 8:19848960-19848982 CAGCAGCAGCGGGTGCAGTGAGG + Intronic
1038251367 8:25908023-25908045 AGGCAGCAGCCCAAGCAGCGTGG - Intronic
1038260558 8:25989834-25989856 CAGAAGCAACAGCAGCAGCAAGG + Intronic
1038455440 8:27669545-27669567 CAGCAGCAGTGGCAGCAGCCTGG - Intronic
1039082353 8:33745482-33745504 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1039467982 8:37797303-37797325 CAGCGGCAGCAGCAGGCGCGCGG - Exonic
1040370345 8:46764760-46764782 CAGTAGCAGCAGTAGCACCTAGG - Intergenic
1041167442 8:55103172-55103194 CAGCGGCAGCAACAGCAGCGGGG + Exonic
1041232546 8:55768395-55768417 CAGCTGCAGCAGCAGCAGCAAGG - Intronic
1041393298 8:57367049-57367071 CAGCGGGAGCAGAGGCAGTGTGG - Intergenic
1041802193 8:61812444-61812466 CAGCAGCATCAGAAAGAGGGTGG - Intergenic
1041871900 8:62644207-62644229 TAGTAGCAGCAGGAGCAGTGAGG - Intronic
1042444024 8:68862548-68862570 CGGCAGCAGCAGCAGCAGGTGGG - Intergenic
1042573005 8:70187126-70187148 AGGCAGCAGGAGAAGCAGTGAGG + Intronic
1042915868 8:73875581-73875603 CAGCAGCAGCAGCAACATCCTGG + Intronic
1043031010 8:75133500-75133522 CAGCAGCATCAGAAGCACAAGGG - Intergenic
1043080583 8:75760647-75760669 CAGCAACAGCTGGAGCAGCTGGG - Intergenic
1043131810 8:76472188-76472210 CAGCAGCAGCAGTAGCATGCAGG + Intergenic
1043485869 8:80698744-80698766 CAGCATCAGCAGAGGCAGCCCGG + Intronic
1043886056 8:85601992-85602014 TAGCAGCAACAAAAGCAGCCAGG + Intergenic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1044313883 8:90727063-90727085 CAGCAGCGGCAGCAGCAGCATGG - Intronic
1044900700 8:96941174-96941196 CAGCAGCAGCAGCAGCACCAGGG - Intronic
1044923075 8:97186117-97186139 CTACAGCAGCAGCAGCAACGTGG + Intergenic
1045183430 8:99811525-99811547 CAGCAGCATCAGCAGCACCTGGG - Intronic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1045293139 8:100850798-100850820 CAGCATCAGCAAAAGCTGCCTGG - Intergenic
1045398855 8:101790916-101790938 CAGCAGTAGCAGCAGCAGCAAGG + Intronic
1045438700 8:102189175-102189197 CAGCAGCATCAGCATCACCGTGG - Intergenic
1045499398 8:102733431-102733453 CAGCAGCAGGAGCAGCAGCATGG + Intergenic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1045718320 8:105074908-105074930 CAGCAGCAGCAGCAGCGGGAGGG - Intronic
1045824926 8:106386071-106386093 GGGCAGCAGCAGCAGCAGCAAGG + Intronic
1045852904 8:106724535-106724557 CATCAGCAGCAGCAGCACCTGGG + Intronic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1046366254 8:113236435-113236457 CAGCAGCACAATAAGCTGCGGGG + Intronic
1047021348 8:120777930-120777952 CAGCAGCAGCAGAAACACTTTGG + Intronic
1047298629 8:123593469-123593491 TAGCTGGAGCAAAAGCAGCGAGG + Intergenic
1047412420 8:124634770-124634792 CAGCAGCAGCAGAATCACCTGGG + Intronic
1047493074 8:125390225-125390247 TGGCAGCGGCAGCAGCAGCGTGG - Intergenic
1047645527 8:126866118-126866140 CAGCAGCATCAGCATCAGCTGGG - Intergenic
1047836914 8:128703804-128703826 CTGCAGCAGCAGCAGCAACTTGG - Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048472925 8:134719441-134719463 GCCCAGCAGCAGCAGCAGCGAGG + Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048765329 8:137837545-137837567 AAGCAGCAGCAGCAGCAGTTTGG + Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1048993711 8:139776000-139776022 CAGAAGCAACAGAAGCTGGGAGG - Intronic
1049025916 8:139988757-139988779 CGTCAGCACCAGGAGCAGCGAGG - Exonic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049791082 8:144473032-144473054 CACCTGCAGCAGCAGCACCGCGG - Exonic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1049923773 9:389605-389627 CAGCAGCAGCAGCAGCACCCAGG + Intronic
1050052773 9:1620547-1620569 CAGCAGCAGCAGCAGCTGTTTGG + Intergenic
1050733242 9:8733808-8733830 GAGGAGCAGCAGCAGCAGCCTGG + Exonic
1050928471 9:11296460-11296482 TAGCAGCAGCAACAGCAGCACGG + Intergenic
1050928472 9:11296463-11296485 CAGCAGCAACAGCAGCACGGTGG + Intergenic
1051145763 9:14025819-14025841 CCACAGCAGCAGAAGAAGTGTGG + Intergenic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1051253346 9:15185503-15185525 CAGCAGCAGCAGCATCACCTGGG + Intronic
1051266699 9:15316166-15316188 CAGCAGCAGCAGCAGCAAGTGGG - Intergenic
1051774894 9:20622463-20622485 CAGCAGCAGCAGCAGCTCCAGGG + Exonic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052799281 9:32952667-32952689 CAGCTGGAGCAGGAGCAGGGTGG + Intergenic
1053119940 9:35538884-35538906 CAGCAGCCGCGGCAGCAGCACGG + Exonic
1053371317 9:37564088-37564110 CTGCTGCAGCTGAAGCAGCTGGG - Intronic
1053511271 9:38689739-38689761 CGGCAGCAGCAGCAACAGCAGGG - Intergenic
1053542847 9:38993161-38993183 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053619627 9:39802285-39802307 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1053646434 9:40122375-40122397 CCCCAGCAGCAGTAGCAGCAGGG - Intergenic
1053693810 9:40616634-40616656 GAGCAGCAGCAGGAGCTGCCAGG + Intergenic
1053759279 9:41341176-41341198 CCCCAGCAGCAGTAGCAGCAGGG + Intergenic
1053807293 9:41816678-41816700 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053940796 9:43247060-43247082 GAGCAGCAGCAGGAGCTGCCAGG + Intergenic
1054264531 9:62905158-62905180 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1054271029 9:63023505-63023527 GAGCAGCAGCAGGAGCTGCCAGG - Intergenic
1054305055 9:63415858-63415880 GAGCAGCAGCAGGAGCTGCCAGG + Intergenic
1054327446 9:63720277-63720299 CCCCAGCAGCAGTAGCAGCAGGG - Intergenic
1054403800 9:64739838-64739860 GAGCAGCAGCAGGAGCTGCCAGG + Intergenic
1054437419 9:65225348-65225370 GAGCAGCAGCAGAAGCTGCCAGG + Intergenic
1054447666 9:65385470-65385492 CAGCGGCAGCAGGAGCATCGCGG + Intergenic
1054492983 9:65796633-65796655 GAGCAGCAGCAGGAGCTGCCAGG - Intergenic
1054538135 9:66253598-66253620 CCCCAGCAGCAGTAGCAGCAGGG + Intergenic
1054623299 9:67370749-67370771 CAGCAGCAGCAGTGGCAGCGAGG - Intergenic
1054716635 9:68563535-68563557 CGGCAGCAGCAGCATCAGCTGGG + Intergenic
1054782032 9:69174313-69174335 CAGGAGCAGAAGCAGAAGCGGGG + Intronic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055370300 9:75591283-75591305 CAGTAGCAGCAGAACCAACTGGG - Intergenic
1055391506 9:75826775-75826797 CAGCAGCATCAGTAGCAAGGAGG + Intergenic
1055774393 9:79752166-79752188 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1056364253 9:85887242-85887264 CAGCAGCATCAGCAGCATCTGGG - Intergenic
1056572594 9:87828699-87828721 CAGCAGTGGCAGAGGCAGCATGG - Intergenic
1056716919 9:89039007-89039029 CAGCAGCAAAAGAAGTAGCCAGG + Intronic
1056947110 9:91007314-91007336 CAGCTGGGGCAGAAGCAGCTGGG - Intergenic
1057043177 9:91862360-91862382 GAGCAGCAGGAGCAGCAGCCAGG + Intronic
1057890584 9:98867038-98867060 CAGCAGCCGAAGTAGCAGCAAGG - Intergenic
1058186671 9:101863584-101863606 CAGCACAAGCAGAAGCATAGAGG - Intergenic
1059249633 9:112877114-112877136 CAGCAGCAGCAGCATCACCTGGG - Intronic
1059288371 9:113198128-113198150 CAGCAGCAGGAGGAGCACTGGGG - Intronic
1059386645 9:113969775-113969797 CAGCAACAGCAGCGGCAGCATGG - Intronic
1060486172 9:124048178-124048200 CAGCAACACCAGAAGAAACGTGG - Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060835951 9:126755390-126755412 CAGCAGGGGCAGGAGCAGCTTGG + Intergenic
1061089959 9:128420894-128420916 CAGCAGCTGGAGCAGCGGCGCGG - Exonic
1061320320 9:129824047-129824069 CAGCAGCAGCAGGCCCAGCACGG + Exonic
1061483055 9:130906596-130906618 CAGCAGCAGGAGAGTCAGGGAGG - Intronic
1061506974 9:131036948-131036970 CAGCAGCACCAGCACCAGCTGGG - Intronic
1061551720 9:131338759-131338781 CAGCACCTTCAGACGCAGCGTGG + Intergenic
1061897415 9:133655680-133655702 CAGCAGCTTCACAAACAGCGGGG + Intronic
1062084618 9:134642237-134642259 CAGCAGCGGGGGCAGCAGCGGGG - Exonic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062098936 9:134717982-134718004 CAGCAGCATGAGAAGCAGCCTGG + Intronic
1062145044 9:134984461-134984483 CAGCAGCAGCAGGAGCCCTGTGG - Intergenic
1062309156 9:135926659-135926681 CAGCACCAGCTGAAGGAGAGAGG - Intergenic
1062403702 9:136383536-136383558 CAGCAGCAGCAGCAGCGAGGAGG - Exonic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062467394 9:136687313-136687335 CAGCAGCAACAGCAGCGCCGCGG + Exonic
1062542072 9:137045942-137045964 CAGCAGCCGCAGGTGCCGCGGGG + Exonic
1062542108 9:137046062-137046084 CGGGAGCAGCGGAGGCAGCGGGG + Exonic
1062634728 9:137484833-137484855 CAGCAGCACCAGAGGCCGCCTGG + Intronic
1203529251 Un_GL000213v1:122773-122795 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1203664854 Un_KI270754v1:15318-15340 GAGCGGCAGCAGGAGCATCGCGG - Intergenic
1203665418 Un_KI270754v1:18134-18156 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203666565 Un_KI270754v1:23770-23792 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203667714 Un_KI270754v1:29409-29431 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203668859 Un_KI270754v1:35051-35073 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203669706 Un_KI270754v1:39274-39296 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1186443205 X:9603832-9603854 CAGCAACACCAAAAGCAGCAAGG - Intronic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186750261 X:12614415-12614437 CAGCAGCATCAGCAGCACCTGGG + Intronic
1186880084 X:13856382-13856404 CAGCAGCAGCAGCAGCATCTGGG + Intronic
1186890909 X:13958254-13958276 CAGCAGCAACAGTATCAGCTGGG + Intergenic
1187067525 X:15854946-15854968 CAGCGGCACCGGAGGCAGCGCGG + Intronic
1187256564 X:17648366-17648388 CAGCAGAAGCAGAAGTTGCAAGG + Intronic
1187274851 X:17808232-17808254 CAGCAGCAGCAGCAGCACCCAGG + Intronic
1187367994 X:18680193-18680215 CAGCAGCAGCAAAGGCCCCGAGG - Intronic
1188437121 X:30173694-30173716 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1188707893 X:33357809-33357831 CAGCAGTGGCAGGAGCAGCAAGG - Intergenic
1188803293 X:34557977-34557999 CAGCAGCATCAGGAGCACCTGGG - Intergenic
1188841702 X:35025030-35025052 GAGCAGAAGGAGAAGCAGCCAGG + Intergenic
1188876524 X:35437304-35437326 CAGAAGCAACTGAAGCAGCAGGG + Intergenic
1188988440 X:36788996-36789018 GAGCAGAAGGAGAAGCAGCCAGG - Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189207640 X:39255680-39255702 CAGTAACAGCAGAAGCTGCCAGG + Intergenic
1189211929 X:39290980-39291002 CAGCAGCATCAGCAGCAGCTGGG - Intergenic
1189318570 X:40073500-40073522 CAGTAGCAGCACCAGCAGCAAGG - Exonic
1189558046 X:42165715-42165737 CAGCAGTGGCAGCAGCAGCACGG + Intergenic
1189683620 X:43541557-43541579 CAGCAGCAGGAGAAGCATCTGGG + Intergenic
1189959200 X:46308303-46308325 GAGCAGCAGGAGCAGCAGCTAGG - Intergenic
1189987871 X:46570177-46570199 CAGGAGCATCAGAAGCACCCAGG + Intergenic
1189992818 X:46610626-46610648 CAGCAGCAGCAGCAGGACCGAGG + Intronic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190635042 X:52425017-52425039 CTGCAGCAGCAGTAACAGCAAGG + Intergenic
1190887076 X:54539716-54539738 CAGCAGTAGCAGCAGCACCTGGG - Intronic
1191128186 X:56980618-56980640 GGGCAGCAGCAGTAGCAGCGTGG + Intronic
1191225742 X:58040913-58040935 CAACAGCAACAGTAGCAGCATGG - Intergenic
1191642436 X:63441868-63441890 TAGCAGCAGCTGCAGCAGTGTGG - Intergenic
1191666239 X:63705718-63705740 CAGCAGCATCAGAATCACCAGGG + Intronic
1191695552 X:63986079-63986101 TAGCAGCAGCAGTGGCAGTGTGG - Intergenic
1191713133 X:64174156-64174178 CAGCATCAGCAGAAGCAAGTTGG - Intergenic
1191840849 X:65512834-65512856 CAGCAGCAGCAGCAACTTCGAGG - Exonic
1192034132 X:67545399-67545421 AGGCAGCAGCAGCAGCAGCAGGG + Exonic
1192307805 X:69981973-69981995 CAGCAGCATCTGAAGCATAGTGG + Intronic
1193466466 X:81853325-81853347 CAGCTGCAGCTGGAGCAGCTGGG + Intergenic
1193736214 X:85159838-85159860 CAGCAGCAGCAGTGGCAGCATGG - Intergenic
1193894684 X:87098673-87098695 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1194212046 X:91081923-91081945 CAGCTGGAGCAGGAGCAGCTAGG + Intergenic
1194217410 X:91148060-91148082 CAGCAGCGGCAGTGGCAGCATGG + Intergenic
1194323465 X:92480932-92480954 CAGCAGCGACAGAGGCAGCATGG + Intronic
1194346719 X:92773995-92774017 CAGCAGCAGCAAAGGCAGCATGG - Intergenic
1194425393 X:93731340-93731362 CAGCAGCAGCAGCAGCACCCTGG - Intergenic
1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG + Intergenic
1194582804 X:95697437-95697459 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1195372231 X:104188156-104188178 CAGCAGCAGCAGTGCCAGCATGG + Exonic
1195533247 X:105982059-105982081 CAGCAGCAGTAGAGGCACCATGG + Intergenic
1195544491 X:106100104-106100126 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1195608380 X:106835322-106835344 CAGCTGGAGCTGAAGCAGCTGGG + Intronic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196117576 X:112014128-112014150 CAGCAGCACCAGCAGCACCTGGG - Intronic
1196193255 X:112815539-112815561 CAGCAGCCACAGCAGCAGCCAGG - Exonic
1196804469 X:119572340-119572362 CAGCAACAGCAGAACCAGAACGG - Intergenic
1196893838 X:120313988-120314010 TAGCAGCAGCTGCAGCAGCTTGG + Intergenic
1196914114 X:120514140-120514162 AAGGAGGAGCAGAAGCAACGGGG - Intergenic
1197104996 X:122703134-122703156 TAGCAGCAGCAGCAGCAGGCAGG + Intergenic
1197141558 X:123122464-123122486 CAGCAGCAGCAGCAGCTTGGTGG - Intergenic
1197570759 X:128147607-128147629 CAGCAGCAGCAGTGACAGCCTGG - Intergenic
1197594406 X:128449257-128449279 CAGCTGGAGCTGAAGCAGCTAGG + Intergenic
1197773597 X:130106202-130106224 CAGCAGCAGCTGGAGGAGGGAGG - Intronic
1198044944 X:132892325-132892347 CAGTAGCAGCAGCAGCACCTTGG + Intronic
1198415804 X:136418600-136418622 CAGCAGCAGCAGAACAATCAAGG - Intergenic
1198502647 X:137267315-137267337 CAGCAGCATCAGCATCAGCTGGG - Intergenic
1198629283 X:138616901-138616923 CAGCTGAAGCTGAAGCAGCTGGG + Intergenic
1198947070 X:142027161-142027183 CAGCTGGAGCTGAAGCAGCTGGG + Intergenic
1198975023 X:142327049-142327071 GAGCAGCAGCAGTGGCAGCATGG + Intergenic
1199003014 X:142662840-142662862 CAGCTGGAGCTGAAGCAGCTGGG - Intergenic
1199113300 X:143959576-143959598 CAGCCACAGCTGAAGCAGCTGGG + Intergenic
1199346521 X:146747054-146747076 CAGCTGTAGCTGAAGCAGCTGGG + Intergenic
1199612713 X:149631682-149631704 CAGTAGCGGGAGCAGCAGCGTGG - Exonic
1199649728 X:149939558-149939580 CAGCCGCGGGAGAAGCAGGGGGG + Intergenic
1199781208 X:151061690-151061712 CAGCAGGAGCAGAAACATGGTGG - Intergenic
1200102646 X:153695582-153695604 CAGAAGCAGCAGTGGCAGCTTGG + Exonic
1200109244 X:153731315-153731337 CAGCAGCTACAGAAGAAGCAGGG - Intronic
1200110073 X:153736541-153736563 CTGCAGCAGCAGCAGGGGCGGGG - Intronic
1200110078 X:153736547-153736569 CAGCACCTGCAGCAGCAGCAGGG - Intronic
1200553924 Y:4611852-4611874 CAGCAGCGGCAGTGGCAGCATGG + Intergenic
1200631566 Y:5594098-5594120 CAGCAGCGACAGAGGCAGCATGG + Intronic
1200655052 Y:5890639-5890661 CAGCAGCAGCAAAGGCAGCATGG - Intergenic
1201142969 Y:11043706-11043728 CGGCAGCAGCAGTAGCACCTTGG - Intergenic
1201232642 Y:11879764-11879786 CAGCAGCTGCGGAGGCTGCGTGG - Intergenic
1201300196 Y:12498566-12498588 CAGCAGCAGGAGCGGCAGGGAGG - Intergenic
1201300197 Y:12498569-12498591 AAGCAGCAGCAGGAGCGGCAGGG - Intergenic
1201943347 Y:19483210-19483232 AAGCAGCAGCACTAGCAGCAAGG - Intergenic
1202335109 Y:23800819-23800841 CAGCATGAGCTGAAGCAGGGTGG + Intergenic
1202535658 Y:25869240-25869262 CAGCATGAGCTGAAGCAGGGTGG - Intergenic