ID: 909172609

View in Genome Browser
Species Human (GRCh38)
Location 1:72315466-72315488
Sequence AATTATCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909172605_909172609 13 Left 909172605 1:72315430-72315452 CCAGTAAGAGGACAAGAGCCATC No data
Right 909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG No data
909172607_909172609 -5 Left 909172607 1:72315448-72315470 CCATCTCAAAAGGAGAGTAATTA No data
Right 909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG No data
909172604_909172609 14 Left 909172604 1:72315429-72315451 CCCAGTAAGAGGACAAGAGCCAT No data
Right 909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG No data
909172603_909172609 20 Left 909172603 1:72315423-72315445 CCAAAGCCCAGTAAGAGGACAAG No data
Right 909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909172609 Original CRISPR AATTATCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr