ID: 909174085

View in Genome Browser
Species Human (GRCh38)
Location 1:72333421-72333443
Sequence GTCAGCAATGTTAATATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909174085_909174086 1 Left 909174085 1:72333421-72333443 CCTGGAATATTAACATTGCTGAC No data
Right 909174086 1:72333445-72333467 TTGTTCATGCACCATCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909174085 Original CRISPR GTCAGCAATGTTAATATTCC AGG (reversed) Intergenic
No off target data available for this crispr