ID: 909174577

View in Genome Browser
Species Human (GRCh38)
Location 1:72339980-72340002
Sequence AAAAAGGCAATATGGGGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909174577_909174583 7 Left 909174577 1:72339980-72340002 CCCATTCCCCATATTGCCTTTTT No data
Right 909174583 1:72340010-72340032 TAATGCCTTTTGATGAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909174577 Original CRISPR AAAAAGGCAATATGGGGAAT GGG (reversed) Intergenic
No off target data available for this crispr