ID: 909177218

View in Genome Browser
Species Human (GRCh38)
Location 1:72376560-72376582
Sequence CCAGCAGAGTACCTGAAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909177218_909177222 19 Left 909177218 1:72376560-72376582 CCATACTTCAGGTACTCTGCTGG No data
Right 909177222 1:72376602-72376624 ATAAATCTTTCGTGGAAGATGGG No data
909177218_909177220 11 Left 909177218 1:72376560-72376582 CCATACTTCAGGTACTCTGCTGG No data
Right 909177220 1:72376594-72376616 ATTTCTTAATAAATCTTTCGTGG No data
909177218_909177221 18 Left 909177218 1:72376560-72376582 CCATACTTCAGGTACTCTGCTGG No data
Right 909177221 1:72376601-72376623 AATAAATCTTTCGTGGAAGATGG No data
909177218_909177223 20 Left 909177218 1:72376560-72376582 CCATACTTCAGGTACTCTGCTGG No data
Right 909177223 1:72376603-72376625 TAAATCTTTCGTGGAAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909177218 Original CRISPR CCAGCAGAGTACCTGAAGTA TGG (reversed) Intergenic
No off target data available for this crispr