ID: 909181809

View in Genome Browser
Species Human (GRCh38)
Location 1:72433773-72433795
Sequence TGGAATCATAACCATAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909181809_909181811 -7 Left 909181809 1:72433773-72433795 CCAATCCTATGGTTATGATTCCA No data
Right 909181811 1:72433789-72433811 GATTCCACTTTTAGCATTTACGG No data
909181809_909181816 22 Left 909181809 1:72433773-72433795 CCAATCCTATGGTTATGATTCCA No data
Right 909181816 1:72433818-72433840 TAACTGGCAGAAAGCCACATGGG No data
909181809_909181812 -4 Left 909181809 1:72433773-72433795 CCAATCCTATGGTTATGATTCCA No data
Right 909181812 1:72433792-72433814 TCCACTTTTAGCATTTACGGTGG No data
909181809_909181814 6 Left 909181809 1:72433773-72433795 CCAATCCTATGGTTATGATTCCA No data
Right 909181814 1:72433802-72433824 GCATTTACGGTGGTAATAACTGG No data
909181809_909181815 21 Left 909181809 1:72433773-72433795 CCAATCCTATGGTTATGATTCCA No data
Right 909181815 1:72433817-72433839 ATAACTGGCAGAAAGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909181809 Original CRISPR TGGAATCATAACCATAGGAT TGG (reversed) Intergenic