ID: 909181810

View in Genome Browser
Species Human (GRCh38)
Location 1:72433778-72433800
Sequence AAAAGTGGAATCATAACCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909181810_909181815 16 Left 909181810 1:72433778-72433800 CCTATGGTTATGATTCCACTTTT No data
Right 909181815 1:72433817-72433839 ATAACTGGCAGAAAGCCACATGG No data
909181810_909181812 -9 Left 909181810 1:72433778-72433800 CCTATGGTTATGATTCCACTTTT No data
Right 909181812 1:72433792-72433814 TCCACTTTTAGCATTTACGGTGG No data
909181810_909181816 17 Left 909181810 1:72433778-72433800 CCTATGGTTATGATTCCACTTTT No data
Right 909181816 1:72433818-72433840 TAACTGGCAGAAAGCCACATGGG No data
909181810_909181814 1 Left 909181810 1:72433778-72433800 CCTATGGTTATGATTCCACTTTT No data
Right 909181814 1:72433802-72433824 GCATTTACGGTGGTAATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909181810 Original CRISPR AAAAGTGGAATCATAACCAT AGG (reversed) Intergenic
No off target data available for this crispr