ID: 909181811

View in Genome Browser
Species Human (GRCh38)
Location 1:72433789-72433811
Sequence GATTCCACTTTTAGCATTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909181809_909181811 -7 Left 909181809 1:72433773-72433795 CCAATCCTATGGTTATGATTCCA No data
Right 909181811 1:72433789-72433811 GATTCCACTTTTAGCATTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909181811 Original CRISPR GATTCCACTTTTAGCATTTA CGG Intergenic
No off target data available for this crispr