ID: 909181812

View in Genome Browser
Species Human (GRCh38)
Location 1:72433792-72433814
Sequence TCCACTTTTAGCATTTACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909181809_909181812 -4 Left 909181809 1:72433773-72433795 CCAATCCTATGGTTATGATTCCA No data
Right 909181812 1:72433792-72433814 TCCACTTTTAGCATTTACGGTGG No data
909181810_909181812 -9 Left 909181810 1:72433778-72433800 CCTATGGTTATGATTCCACTTTT No data
Right 909181812 1:72433792-72433814 TCCACTTTTAGCATTTACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909181812 Original CRISPR TCCACTTTTAGCATTTACGG TGG Intergenic
No off target data available for this crispr