ID: 909181813

View in Genome Browser
Species Human (GRCh38)
Location 1:72433793-72433815
Sequence ACCACCGTAAATGCTAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909181813_909181815 1 Left 909181813 1:72433793-72433815 CCACTTTTAGCATTTACGGTGGT No data
Right 909181815 1:72433817-72433839 ATAACTGGCAGAAAGCCACATGG No data
909181813_909181816 2 Left 909181813 1:72433793-72433815 CCACTTTTAGCATTTACGGTGGT No data
Right 909181816 1:72433818-72433840 TAACTGGCAGAAAGCCACATGGG No data
909181813_909181818 20 Left 909181813 1:72433793-72433815 CCACTTTTAGCATTTACGGTGGT No data
Right 909181818 1:72433836-72433858 ATGGGTTTCCCCAACCAGTGTGG No data
909181813_909181819 21 Left 909181813 1:72433793-72433815 CCACTTTTAGCATTTACGGTGGT No data
Right 909181819 1:72433837-72433859 TGGGTTTCCCCAACCAGTGTGGG No data
909181813_909181820 22 Left 909181813 1:72433793-72433815 CCACTTTTAGCATTTACGGTGGT No data
Right 909181820 1:72433838-72433860 GGGTTTCCCCAACCAGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909181813 Original CRISPR ACCACCGTAAATGCTAAAAG TGG (reversed) Intergenic
No off target data available for this crispr