ID: 909181816

View in Genome Browser
Species Human (GRCh38)
Location 1:72433818-72433840
Sequence TAACTGGCAGAAAGCCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909181809_909181816 22 Left 909181809 1:72433773-72433795 CCAATCCTATGGTTATGATTCCA No data
Right 909181816 1:72433818-72433840 TAACTGGCAGAAAGCCACATGGG No data
909181810_909181816 17 Left 909181810 1:72433778-72433800 CCTATGGTTATGATTCCACTTTT No data
Right 909181816 1:72433818-72433840 TAACTGGCAGAAAGCCACATGGG No data
909181813_909181816 2 Left 909181813 1:72433793-72433815 CCACTTTTAGCATTTACGGTGGT No data
Right 909181816 1:72433818-72433840 TAACTGGCAGAAAGCCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909181816 Original CRISPR TAACTGGCAGAAAGCCACAT GGG Intergenic
No off target data available for this crispr