ID: 909198750

View in Genome Browser
Species Human (GRCh38)
Location 1:72661380-72661402
Sequence AGTTGTGGTTCTTCCTCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909198746_909198750 27 Left 909198746 1:72661330-72661352 CCACTGTTGGTGATAGTCTTATA No data
Right 909198750 1:72661380-72661402 AGTTGTGGTTCTTCCTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909198750 Original CRISPR AGTTGTGGTTCTTCCTCTAA GGG Intergenic
No off target data available for this crispr