ID: 909201150

View in Genome Browser
Species Human (GRCh38)
Location 1:72691867-72691889
Sequence ATTTTGTCCTGGGGGTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909201141_909201150 25 Left 909201141 1:72691819-72691841 CCAGCCAGAACAGAGAGCCCCTT No data
Right 909201150 1:72691867-72691889 ATTTTGTCCTGGGGGTTCTTTGG No data
909201143_909201150 8 Left 909201143 1:72691836-72691858 CCCCTTCAACTCAAGAATAATAG No data
Right 909201150 1:72691867-72691889 ATTTTGTCCTGGGGGTTCTTTGG No data
909201142_909201150 21 Left 909201142 1:72691823-72691845 CCAGAACAGAGAGCCCCTTCAAC No data
Right 909201150 1:72691867-72691889 ATTTTGTCCTGGGGGTTCTTTGG No data
909201145_909201150 6 Left 909201145 1:72691838-72691860 CCTTCAACTCAAGAATAATAGAC No data
Right 909201150 1:72691867-72691889 ATTTTGTCCTGGGGGTTCTTTGG No data
909201144_909201150 7 Left 909201144 1:72691837-72691859 CCCTTCAACTCAAGAATAATAGA No data
Right 909201150 1:72691867-72691889 ATTTTGTCCTGGGGGTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909201150 Original CRISPR ATTTTGTCCTGGGGGTTCTT TGG Intergenic
No off target data available for this crispr