ID: 909203709

View in Genome Browser
Species Human (GRCh38)
Location 1:72725900-72725922
Sequence GGTCACTACACTCCAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909203709_909203713 15 Left 909203709 1:72725900-72725922 CCATCCATTGGAGTGTAGTGACC No data
Right 909203713 1:72725938-72725960 CATCAGCGCCCCTAGTACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909203709 Original CRISPR GGTCACTACACTCCAATGGA TGG (reversed) Intergenic
No off target data available for this crispr