ID: 909204967

View in Genome Browser
Species Human (GRCh38)
Location 1:72744199-72744221
Sequence TTTACTCAGGATGTGGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909204967_909204973 8 Left 909204967 1:72744199-72744221 CCAAATGCCACATCCTGAGTAAA No data
Right 909204973 1:72744230-72744252 ACAGGAGAGAAATCCTGAATGGG No data
909204967_909204971 -10 Left 909204967 1:72744199-72744221 CCAAATGCCACATCCTGAGTAAA No data
Right 909204971 1:72744212-72744234 CCTGAGTAAACAATATGGACAGG No data
909204967_909204972 7 Left 909204967 1:72744199-72744221 CCAAATGCCACATCCTGAGTAAA No data
Right 909204972 1:72744229-72744251 GACAGGAGAGAAATCCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909204967 Original CRISPR TTTACTCAGGATGTGGCATT TGG (reversed) Intergenic
No off target data available for this crispr