ID: 909208042

View in Genome Browser
Species Human (GRCh38)
Location 1:72785790-72785812
Sequence TGGTAATATGTATGAATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909208040_909208042 12 Left 909208040 1:72785755-72785777 CCTTCATAGTTTGCTGCTCATCA No data
Right 909208042 1:72785790-72785812 TGGTAATATGTATGAATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909208042 Original CRISPR TGGTAATATGTATGAATAAT TGG Intergenic
No off target data available for this crispr