ID: 909209977

View in Genome Browser
Species Human (GRCh38)
Location 1:72810700-72810722
Sequence ATGTCCTTCTAGAAGACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909209975_909209977 2 Left 909209975 1:72810675-72810697 CCATGGAAAAAGGACCTAACAAA 0: 39
1: 40
2: 27
3: 29
4: 254
Right 909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG No data
909209973_909209977 18 Left 909209973 1:72810659-72810681 CCTCTTTTATTCTAAACCATGGA 0: 17
1: 21
2: 24
3: 47
4: 248
Right 909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909209977 Original CRISPR ATGTCCTTCTAGAAGACTGA AGG Intergenic
No off target data available for this crispr