ID: 909212662

View in Genome Browser
Species Human (GRCh38)
Location 1:72844217-72844239
Sequence TGCCATCTCCCTAGGGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909212662_909212667 30 Left 909212662 1:72844217-72844239 CCCAAGCCCCTAGGGAGATGGCA No data
Right 909212667 1:72844270-72844292 TTTAATTCCCAACTTAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909212662 Original CRISPR TGCCATCTCCCTAGGGGCTT GGG (reversed) Intergenic
No off target data available for this crispr