ID: 909212663

View in Genome Browser
Species Human (GRCh38)
Location 1:72844218-72844240
Sequence GTGCCATCTCCCTAGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909212663_909212668 30 Left 909212663 1:72844218-72844240 CCAAGCCCCTAGGGAGATGGCAC No data
Right 909212668 1:72844271-72844293 TTAATTCCCAACTTAACTGTGGG No data
909212663_909212667 29 Left 909212663 1:72844218-72844240 CCAAGCCCCTAGGGAGATGGCAC No data
Right 909212667 1:72844270-72844292 TTTAATTCCCAACTTAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909212663 Original CRISPR GTGCCATCTCCCTAGGGGCT TGG (reversed) Intergenic
No off target data available for this crispr