ID: 909212664

View in Genome Browser
Species Human (GRCh38)
Location 1:72844223-72844245
Sequence TATGAGTGCCATCTCCCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909212664_909212668 25 Left 909212664 1:72844223-72844245 CCCCTAGGGAGATGGCACTCATA No data
Right 909212668 1:72844271-72844293 TTAATTCCCAACTTAACTGTGGG No data
909212664_909212667 24 Left 909212664 1:72844223-72844245 CCCCTAGGGAGATGGCACTCATA No data
Right 909212667 1:72844270-72844292 TTTAATTCCCAACTTAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909212664 Original CRISPR TATGAGTGCCATCTCCCTAG GGG (reversed) Intergenic
No off target data available for this crispr