ID: 909212666

View in Genome Browser
Species Human (GRCh38)
Location 1:72844225-72844247
Sequence GCTATGAGTGCCATCTCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909212666_909212667 22 Left 909212666 1:72844225-72844247 CCTAGGGAGATGGCACTCATAGC No data
Right 909212667 1:72844270-72844292 TTTAATTCCCAACTTAACTGTGG No data
909212666_909212668 23 Left 909212666 1:72844225-72844247 CCTAGGGAGATGGCACTCATAGC No data
Right 909212668 1:72844271-72844293 TTAATTCCCAACTTAACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909212666 Original CRISPR GCTATGAGTGCCATCTCCCT AGG (reversed) Intergenic
No off target data available for this crispr