ID: 909212667

View in Genome Browser
Species Human (GRCh38)
Location 1:72844270-72844292
Sequence TTTAATTCCCAACTTAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909212665_909212667 23 Left 909212665 1:72844224-72844246 CCCTAGGGAGATGGCACTCATAG No data
Right 909212667 1:72844270-72844292 TTTAATTCCCAACTTAACTGTGG No data
909212663_909212667 29 Left 909212663 1:72844218-72844240 CCAAGCCCCTAGGGAGATGGCAC No data
Right 909212667 1:72844270-72844292 TTTAATTCCCAACTTAACTGTGG No data
909212666_909212667 22 Left 909212666 1:72844225-72844247 CCTAGGGAGATGGCACTCATAGC No data
Right 909212667 1:72844270-72844292 TTTAATTCCCAACTTAACTGTGG No data
909212662_909212667 30 Left 909212662 1:72844217-72844239 CCCAAGCCCCTAGGGAGATGGCA No data
Right 909212667 1:72844270-72844292 TTTAATTCCCAACTTAACTGTGG No data
909212664_909212667 24 Left 909212664 1:72844223-72844245 CCCCTAGGGAGATGGCACTCATA No data
Right 909212667 1:72844270-72844292 TTTAATTCCCAACTTAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909212667 Original CRISPR TTTAATTCCCAACTTAACTG TGG Intergenic
No off target data available for this crispr