ID: 909216610

View in Genome Browser
Species Human (GRCh38)
Location 1:72899069-72899091
Sequence GCGCCGTTTTTTAAGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909216610_909216613 1 Left 909216610 1:72899069-72899091 CCAACCAGCTTAAAAAACGGCGC No data
Right 909216613 1:72899093-72899115 CCACGACATTATATCGCACCTGG 0: 1
1: 0
2: 1
3: 4
4: 18
909216610_909216616 10 Left 909216610 1:72899069-72899091 CCAACCAGCTTAAAAAACGGCGC No data
Right 909216616 1:72899102-72899124 TATATCGCACCTGGCTTGGAGGG 0: 1
1: 0
2: 186
3: 940
4: 1726
909216610_909216615 9 Left 909216610 1:72899069-72899091 CCAACCAGCTTAAAAAACGGCGC No data
Right 909216615 1:72899101-72899123 TTATATCGCACCTGGCTTGGAGG 0: 1
1: 0
2: 2
3: 196
4: 1024
909216610_909216618 24 Left 909216610 1:72899069-72899091 CCAACCAGCTTAAAAAACGGCGC No data
Right 909216618 1:72899116-72899138 CTTGGAGGGTCCTACGCCCACGG 0: 187
1: 1248
2: 1570
3: 1067
4: 820
909216610_909216614 6 Left 909216610 1:72899069-72899091 CCAACCAGCTTAAAAAACGGCGC No data
Right 909216614 1:72899098-72899120 ACATTATATCGCACCTGGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909216610 Original CRISPR GCGCCGTTTTTTAAGCTGGT TGG (reversed) Intergenic
No off target data available for this crispr