ID: 909218720

View in Genome Browser
Species Human (GRCh38)
Location 1:72926857-72926879
Sequence TTCCTAAGGAATAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909218720_909218731 27 Left 909218720 1:72926857-72926879 CCTTCTTCCCTATTCCTTAGGAA No data
Right 909218731 1:72926907-72926929 CTTCCCAGACCCCAATACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909218720 Original CRISPR TTCCTAAGGAATAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr