ID: 909222099

View in Genome Browser
Species Human (GRCh38)
Location 1:72978392-72978414
Sequence ACAGCCACTGTCCCTATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909222099_909222101 19 Left 909222099 1:72978392-72978414 CCTCAAATAGGGACAGTGGCTGT No data
Right 909222101 1:72978434-72978456 GAGAAAGCACAGTTGCAGATTGG No data
909222099_909222102 30 Left 909222099 1:72978392-72978414 CCTCAAATAGGGACAGTGGCTGT No data
Right 909222102 1:72978445-72978467 GTTGCAGATTGGTAAATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909222099 Original CRISPR ACAGCCACTGTCCCTATTTG AGG (reversed) Intergenic
No off target data available for this crispr