ID: 909222100

View in Genome Browser
Species Human (GRCh38)
Location 1:72978416-72978438
Sequence TTCTCTCTCATCATCATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909222100_909222101 -5 Left 909222100 1:72978416-72978438 CCATCTATGATGATGAGAGAGAA No data
Right 909222101 1:72978434-72978456 GAGAAAGCACAGTTGCAGATTGG No data
909222100_909222102 6 Left 909222100 1:72978416-72978438 CCATCTATGATGATGAGAGAGAA No data
Right 909222102 1:72978445-72978467 GTTGCAGATTGGTAAATTGTTGG No data
909222100_909222103 7 Left 909222100 1:72978416-72978438 CCATCTATGATGATGAGAGAGAA No data
Right 909222103 1:72978446-72978468 TTGCAGATTGGTAAATTGTTGGG No data
909222100_909222105 15 Left 909222100 1:72978416-72978438 CCATCTATGATGATGAGAGAGAA No data
Right 909222105 1:72978454-72978476 TGGTAAATTGTTGGGGTGATAGG No data
909222100_909222104 8 Left 909222100 1:72978416-72978438 CCATCTATGATGATGAGAGAGAA No data
Right 909222104 1:72978447-72978469 TGCAGATTGGTAAATTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909222100 Original CRISPR TTCTCTCTCATCATCATAGA TGG (reversed) Intergenic
No off target data available for this crispr