ID: 909222101 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:72978434-72978456 |
| Sequence | GAGAAAGCACAGTTGCAGAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 909222100_909222101 | -5 | Left | 909222100 | 1:72978416-72978438 | CCATCTATGATGATGAGAGAGAA | No data | ||
| Right | 909222101 | 1:72978434-72978456 | GAGAAAGCACAGTTGCAGATTGG | No data | ||||
| 909222099_909222101 | 19 | Left | 909222099 | 1:72978392-72978414 | CCTCAAATAGGGACAGTGGCTGT | No data | ||
| Right | 909222101 | 1:72978434-72978456 | GAGAAAGCACAGTTGCAGATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 909222101 | Original CRISPR | GAGAAAGCACAGTTGCAGAT TGG | Intergenic | ||
| No off target data available for this crispr | |||||