ID: 909222639 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:72983205-72983227 |
| Sequence | GGTCACACACAGATGGGACG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 909222636_909222639 | -9 | Left | 909222636 | 1:72983191-72983213 | CCGATTTTCAGTGGGGTCACACA | No data | ||
| Right | 909222639 | 1:72983205-72983227 | GGTCACACACAGATGGGACGCGG | No data | ||||
| 909222632_909222639 | 9 | Left | 909222632 | 1:72983173-72983195 | CCAGGTGAGTTAAACAGTCCGAT | 0: 3 1: 319 2: 324 3: 127 4: 86 |
||
| Right | 909222639 | 1:72983205-72983227 | GGTCACACACAGATGGGACGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 909222639 | Original CRISPR | GGTCACACACAGATGGGACG CGG | Intergenic | ||
| No off target data available for this crispr | |||||