ID: 909222639

View in Genome Browser
Species Human (GRCh38)
Location 1:72983205-72983227
Sequence GGTCACACACAGATGGGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909222636_909222639 -9 Left 909222636 1:72983191-72983213 CCGATTTTCAGTGGGGTCACACA No data
Right 909222639 1:72983205-72983227 GGTCACACACAGATGGGACGCGG No data
909222632_909222639 9 Left 909222632 1:72983173-72983195 CCAGGTGAGTTAAACAGTCCGAT 0: 3
1: 319
2: 324
3: 127
4: 86
Right 909222639 1:72983205-72983227 GGTCACACACAGATGGGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909222639 Original CRISPR GGTCACACACAGATGGGACG CGG Intergenic
No off target data available for this crispr