ID: 909224407

View in Genome Browser
Species Human (GRCh38)
Location 1:72998787-72998809
Sequence TGTGACTTCTTAGAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909224406_909224407 -4 Left 909224406 1:72998768-72998790 CCAAAGTAGAATGAAAAGATGTG No data
Right 909224407 1:72998787-72998809 TGTGACTTCTTAGAAAAAACAGG No data
909224405_909224407 9 Left 909224405 1:72998755-72998777 CCAGCACAATATTCCAAAGTAGA No data
Right 909224407 1:72998787-72998809 TGTGACTTCTTAGAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909224407 Original CRISPR TGTGACTTCTTAGAAAAAAC AGG Intergenic
No off target data available for this crispr