ID: 909232283

View in Genome Browser
Species Human (GRCh38)
Location 1:73105878-73105900
Sequence CAGCTCGGACAGCTTGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909232283_909232292 16 Left 909232283 1:73105878-73105900 CCAACACCAAGCTGTCCGAGCTG No data
Right 909232292 1:73105917-73105939 AGGCCAAGCAGGACGCAGCGAGG 0: 1
1: 0
2: 0
3: 17
4: 187
909232283_909232288 -4 Left 909232283 1:73105878-73105900 CCAACACCAAGCTGTCCGAGCTG No data
Right 909232288 1:73105897-73105919 GCTGGAGGCCGCCGTGTAGCAGG 0: 1
1: 0
2: 15
3: 25
4: 145
909232283_909232294 26 Left 909232283 1:73105878-73105900 CCAACACCAAGCTGTCCGAGCTG No data
Right 909232294 1:73105927-73105949 GGACGCAGCGAGGCAGCTGCAGG 0: 1
1: 0
2: 0
3: 29
4: 248
909232283_909232290 5 Left 909232283 1:73105878-73105900 CCAACACCAAGCTGTCCGAGCTG No data
Right 909232290 1:73105906-73105928 CGCCGTGTAGCAGGCCAAGCAGG 0: 1
1: 1
2: 3
3: 18
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909232283 Original CRISPR CAGCTCGGACAGCTTGGTGT TGG (reversed) Intergenic
No off target data available for this crispr