ID: 909233952

View in Genome Browser
Species Human (GRCh38)
Location 1:73128503-73128525
Sequence ATCTAAGTCTAGGAGTATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909233949_909233952 -3 Left 909233949 1:73128483-73128505 CCTGCAGGTTAAATGATATGATC No data
Right 909233952 1:73128503-73128525 ATCTAAGTCTAGGAGTATAAGGG No data
909233948_909233952 4 Left 909233948 1:73128476-73128498 CCAATTACCTGCAGGTTAAATGA No data
Right 909233952 1:73128503-73128525 ATCTAAGTCTAGGAGTATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909233952 Original CRISPR ATCTAAGTCTAGGAGTATAA GGG Intergenic
No off target data available for this crispr