ID: 909236019

View in Genome Browser
Species Human (GRCh38)
Location 1:73153345-73153367
Sequence GAAAATGCTGATAGTGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909236019_909236020 -4 Left 909236019 1:73153345-73153367 CCATTATCACTATCAGCATTTTC No data
Right 909236020 1:73153364-73153386 TTTCCATTCAACAGTTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909236019 Original CRISPR GAAAATGCTGATAGTGATAA TGG (reversed) Intergenic
No off target data available for this crispr