ID: 909237465

View in Genome Browser
Species Human (GRCh38)
Location 1:73171843-73171865
Sequence CCCTTTCAGCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909237465_909237471 7 Left 909237465 1:73171843-73171865 CCTTCCTCCTTCTGCTGAAAGGG No data
Right 909237471 1:73171873-73171895 ACAAAAGACACTGAACAAGTTGG No data
909237465_909237472 8 Left 909237465 1:73171843-73171865 CCTTCCTCCTTCTGCTGAAAGGG No data
Right 909237472 1:73171874-73171896 CAAAAGACACTGAACAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909237465 Original CRISPR CCCTTTCAGCAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr