ID: 909238352

View in Genome Browser
Species Human (GRCh38)
Location 1:73180974-73180996
Sequence GGGCCCAAGGAACATGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909238352_909238361 5 Left 909238352 1:73180974-73180996 CCCCTCTCATGTTCCTTGGGCCC No data
Right 909238361 1:73181002-73181024 CTGGAGAGGACTGAGGTTTACGG No data
909238352_909238364 12 Left 909238352 1:73180974-73180996 CCCCTCTCATGTTCCTTGGGCCC No data
Right 909238364 1:73181009-73181031 GGACTGAGGTTTACGGGGATTGG No data
909238352_909238357 -9 Left 909238352 1:73180974-73180996 CCCCTCTCATGTTCCTTGGGCCC No data
Right 909238357 1:73180988-73181010 CTTGGGCCCAAATTCTGGAGAGG No data
909238352_909238362 6 Left 909238352 1:73180974-73180996 CCCCTCTCATGTTCCTTGGGCCC No data
Right 909238362 1:73181003-73181025 TGGAGAGGACTGAGGTTTACGGG No data
909238352_909238360 -2 Left 909238352 1:73180974-73180996 CCCCTCTCATGTTCCTTGGGCCC No data
Right 909238360 1:73180995-73181017 CCAAATTCTGGAGAGGACTGAGG No data
909238352_909238363 7 Left 909238352 1:73180974-73180996 CCCCTCTCATGTTCCTTGGGCCC No data
Right 909238363 1:73181004-73181026 GGAGAGGACTGAGGTTTACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909238352 Original CRISPR GGGCCCAAGGAACATGAGAG GGG (reversed) Intergenic
No off target data available for this crispr