ID: 909238356

View in Genome Browser
Species Human (GRCh38)
Location 1:73180987-73181009
Sequence CTCTCCAGAATTTGGGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909238356_909238363 -6 Left 909238356 1:73180987-73181009 CCTTGGGCCCAAATTCTGGAGAG No data
Right 909238363 1:73181004-73181026 GGAGAGGACTGAGGTTTACGGGG No data
909238356_909238364 -1 Left 909238356 1:73180987-73181009 CCTTGGGCCCAAATTCTGGAGAG No data
Right 909238364 1:73181009-73181031 GGACTGAGGTTTACGGGGATTGG No data
909238356_909238361 -8 Left 909238356 1:73180987-73181009 CCTTGGGCCCAAATTCTGGAGAG No data
Right 909238361 1:73181002-73181024 CTGGAGAGGACTGAGGTTTACGG No data
909238356_909238362 -7 Left 909238356 1:73180987-73181009 CCTTGGGCCCAAATTCTGGAGAG No data
Right 909238362 1:73181003-73181025 TGGAGAGGACTGAGGTTTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909238356 Original CRISPR CTCTCCAGAATTTGGGCCCA AGG (reversed) Intergenic
No off target data available for this crispr