ID: 909238358

View in Genome Browser
Species Human (GRCh38)
Location 1:73180994-73181016
Sequence CTCAGTCCTCTCCAGAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
909238358_909238364 -8 Left 909238358 1:73180994-73181016 CCCAAATTCTGGAGAGGACTGAG No data
Right 909238364 1:73181009-73181031 GGACTGAGGTTTACGGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909238358 Original CRISPR CTCAGTCCTCTCCAGAATTT GGG (reversed) Intergenic
No off target data available for this crispr